IDH3B Rabbit Polyclonal Antibody

IDH3B Rabbit Polyclonal Antibody

Contact Us Below To Order :

IDH3B Polyclonal Antibody
ABP58865-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IDH3B protein
  • Applications tips:
Description: A polyclonal antibody for detection of IDH3B from Human, Rat. This IDH3B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IDH3B protein
IDH3B Polyclonal Antibody
ES11913-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IDH3B from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
IDH3B Polyclonal Antibody
ES11913-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IDH3B from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
IDH3B Rabbit pAb
A13742-100ul 100 ul
EUR 308
IDH3B Rabbit pAb
A13742-200ul 200 ul
EUR 459
IDH3B Rabbit pAb
A13742-20ul 20 ul
EUR 183
IDH3B Rabbit pAb
A13742-50ul 50 ul
EUR 223
IDH3B Antibody
36157-100ul 100ul
EUR 252
IDH3B Antibody
1-CSB-PA05515A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
IDH3B Antibody
1-CSB-PA114986
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
IDH3B Antibody
1-CSB-PA597290
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
IDH3B Antibody
DF8562 200ul
EUR 304
Description: IDH3B Antibody detects endogenous levels of total IDH3B.
IDH3B Antibody
ABD8562 100 ug
EUR 438
Polyclonal IDH3B Antibody (N-term)
APR07935G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IDH3B (N-term). This antibody is tested and proven to work in the following applications:
IDH3B Polyclonal Antibody, Biotin Conjugated
A53683 100 µg
EUR 570.55
Description: Ask the seller for details
IDH3B Polyclonal Antibody, FITC Conjugated
A53684 100 µg
EUR 570.55
Description: The best epigenetics products
IDH3B Polyclonal Antibody, HRP Conjugated
A53685 100 µg
EUR 570.55
Description: kits suitable for this type of research
Polyclonal IDH3B Antibody - N-terminal region
APR07936G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IDH3B - N-terminal region. This antibody is tested and proven to work in the following applications:
IDH3B Antibody (Biotin)
20-abx106325
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
IDH3B Antibody (FITC)
20-abx107738
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
IDH3B Antibody (HRP)
20-abx109156
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
IDH3B Conjugated Antibody
C36157 100ul
EUR 397
Anti-IDH3B antibody
STJ115693 100 µl
EUR 277
Description: Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the beta subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene.
Anti-IDH3B antibody
STJ193071 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IDH3B
Idh3B/ Rat Idh3B ELISA Kit
ELI-43372r 96 Tests
EUR 886
Polyclonal IDH3B (aa369-383) Antibody (C-Term)
APR07933G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IDH3B (aa369-383) (C-Term). This antibody is tested and proven to work in the following applications:
IDH3B siRNA
20-abx920145
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
IDH3B siRNA
20-abx920146
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-IDH3B
YF-PA12530 100 ug
EUR 403
Description: Rabbit polyclonal to IDH3B
IDH3B Antibody, HRP conjugated
1-CSB-PA05515B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
IDH3B Antibody, FITC conjugated
1-CSB-PA05515C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
IDH3B Antibody, Biotin conjugated
1-CSB-PA05515D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Isocitrate dehydrogenase 3 (NAD+) beta (IDH3B) polyclonal antibody
ABP-PAB-01173 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:
IDH3B Blocking Peptide
DF8562-BP 1mg
EUR 195
IDH3B cloning plasmid
CSB-CL010992HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1158
  • Sequence: atggcggcattgagcggagtccgctggctgacccgagcgctggtctccgccgggaaccctggggcatggagaggtctgagtacctcggccgcggcgcacgctgcatcgcggagccaggccgaggacgtgagggtggagggctcctttcccgtgaccatgcttccgggagacggtg
  • Show more
Description: A cloning plasmid for the IDH3B gene.
Anti-IDH3B (3A10)
YF-MA13644 100 ug
EUR 363
Description: Mouse monoclonal to IDH3B
Anti-IDH3B (aa369-383) antibody
STJ72609 100 µg
EUR 359
Anti-IDH3B (aa33-46) antibody
STJ72610 100 µg
EUR 359
Human IDH3B ELISA KIT
ELI-43832h 96 Tests
EUR 824
Rat IDH3B shRNA Plasmid
20-abx987077
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human IDH3B shRNA Plasmid
20-abx952315
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Bovine IDH3B ELISA KIT
ELI-39261b 96 Tests
EUR 928
IDH3B Recombinant Protein (Human)
RP015544 100 ug Ask for price
IDH3B Recombinant Protein (Rat)
RP205454 100 ug Ask for price
IDH3B Recombinant Protein (Mouse)
RP142901 100 ug Ask for price
Polyclonal IDH3B (aa33-46) Antibody (internal region, near N-Term)
APR07932G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IDH3B (aa33-46) (internal region, near N-Term). This antibody is tested and proven to work in the following applications:
Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody
20-abx214033
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody
20-abx214034
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody
20-abx110597
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody
abx036108-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Monoclonal IDH3B Antibody (monoclonal) (M01), Clone: 3A10
APR07934G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human IDH3B (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3A10. This antibody is applicable in E
Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody
abx431403-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody
abx431404-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Idh3B ORF Vector (Rat) (pORF)
ORF068486 1.0 ug DNA
EUR 506
IDH3B ORF Vector (Human) (pORF)
ORF005182 1.0 ug DNA
EUR 95
Idh3b ORF Vector (Mouse) (pORF)
ORF047635 1.0 ug DNA
EUR 506
Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) ELISA kit
E04I0425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) ELISA kit
E04I0425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) ELISA kit
E04I0425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Idh3B sgRNA CRISPR Lentivector set (Rat)
K7043801 3 x 1.0 ug
EUR 339
Idh3b sgRNA CRISPR Lentivector set (Mouse)
K3035201 3 x 1.0 ug
EUR 339
IDH3B sgRNA CRISPR Lentivector set (Human)
K1014901 3 x 1.0 ug
EUR 339
Idh3B sgRNA CRISPR Lentivector (Rat) (Target 1)
K7043802 1.0 ug DNA
EUR 154
Idh3B sgRNA CRISPR Lentivector (Rat) (Target 2)
K7043803 1.0 ug DNA
EUR 154
Idh3B sgRNA CRISPR Lentivector (Rat) (Target 3)
K7043804 1.0 ug DNA
EUR 154
Idh3b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3035202 1.0 ug DNA
EUR 154
Idh3b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3035203 1.0 ug DNA
EUR 154
Idh3b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3035204 1.0 ug DNA
EUR 154
IDH3B sgRNA CRISPR Lentivector (Human) (Target 1)
K1014902 1.0 ug DNA
EUR 154
IDH3B sgRNA CRISPR Lentivector (Human) (Target 2)
K1014903 1.0 ug DNA
EUR 154
IDH3B sgRNA CRISPR Lentivector (Human) (Target 3)
K1014904 1.0 ug DNA
EUR 154
IDH3B Protein Vector (Human) (pPB-C-His)
PV020725 500 ng
EUR 329
IDH3B Protein Vector (Human) (pPB-N-His)
PV020726 500 ng
EUR 329
IDH3B Protein Vector (Human) (pPM-C-HA)
PV020727 500 ng
EUR 329
IDH3B Protein Vector (Human) (pPM-C-His)
PV020728 500 ng
EUR 329
IDH3B Protein Vector (Rat) (pPB-C-His)
PV273942 500 ng
EUR 603
IDH3B Protein Vector (Rat) (pPB-N-His)
PV273943 500 ng
EUR 603
IDH3B Protein Vector (Rat) (pPM-C-HA)
PV273944 500 ng
EUR 603
IDH3B Protein Vector (Rat) (pPM-C-His)
PV273945 500 ng
EUR 603
IDH3B Protein Vector (Mouse) (pPB-C-His)
PV190538 500 ng
EUR 603
IDH3B Protein Vector (Mouse) (pPB-N-His)
PV190539 500 ng
EUR 603
IDH3B Protein Vector (Mouse) (pPM-C-HA)
PV190540 500 ng
EUR 603
IDH3B Protein Vector (Mouse) (pPM-C-His)
PV190541 500 ng
EUR 603
Recombinant Human IDH3B Protein, GST, E.coli-100ug
QP6193-ec-100ug 100ug
EUR 408
Recombinant Human IDH3B Protein, GST, E.coli-10ug
QP6193-ec-10ug 10ug
EUR 200
Recombinant Human IDH3B Protein, GST, E.coli-1mg
QP6193-ec-1mg 1mg
EUR 1632
Recombinant Human IDH3B Protein, GST, E.coli-200ug
QP6193-ec-200ug 200ug
EUR 634
Recombinant Human IDH3B Protein, GST, E.coli-500ug
QP6193-ec-500ug 500ug
EUR 1060
Recombinant Human IDH3B Protein, GST, E.coli-50ug
QP6193-ec-50ug 50ug
EUR 263
Idh3b 3'UTR Luciferase Stable Cell Line
TU109882 1.0 ml Ask for price
Idh3B 3'UTR Luciferase Stable Cell Line
TU206085 1.0 ml Ask for price
Idh3b 3'UTR GFP Stable Cell Line
TU159882 1.0 ml Ask for price
Idh3B 3'UTR GFP Stable Cell Line
TU256085 1.0 ml Ask for price
IDH3B 3'UTR GFP Stable Cell Line
TU060426 1.0 ml
EUR 1394
IDH3B 3'UTR Luciferase Stable Cell Line
TU010426 1.0 ml
EUR 1394
Human Isocitrate dehydrogenase [NAD] subunit beta, mitochondrial (IDH3B)
1-CSB-EP010992HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Isocitrate dehydrogenase [NAD] subunit beta, mitochondrial(IDH3B) expressed in E.coli
IDH3B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV675115 1.0 ug DNA
EUR 682
IDH3B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV675119 1.0 ug DNA
EUR 682
IDH3B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV675120 1.0 ug DNA
EUR 682
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

IDH3B Rabbit Polyclonal Antibody