IDH3B Rabbit Polyclonal Antibody

IDH3B Rabbit Polyclonal Antibody

Contact Us Below To Order :

    IDH3B Polyclonal Antibody
    ABP58865-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human IDH3B protein
    • Applications tips:
    Description: A polyclonal antibody for detection of IDH3B from Human, Rat. This IDH3B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IDH3B protein
    IDH3B Polyclonal Antibody
    ES11913-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IDH3B from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    IDH3B Polyclonal Antibody
    ES11913-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IDH3B from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    IDH3B Rabbit pAb
    A13742-100ul 100 ul
    EUR 308
    IDH3B Rabbit pAb
    A13742-200ul 200 ul
    EUR 459
    IDH3B Rabbit pAb
    A13742-20ul 20 ul
    EUR 183
    IDH3B Rabbit pAb
    A13742-50ul 50 ul
    EUR 223
    IDH3B Antibody
    36157-100ul 100ul
    EUR 252
    IDH3B Antibody
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
    IDH3B Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
    IDH3B Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
    IDH3B Antibody
    DF8562 200ul
    EUR 304
    Description: IDH3B Antibody detects endogenous levels of total IDH3B.
    IDH3B Antibody
    ABD8562 100 ug
    EUR 438
    Polyclonal IDH3B Antibody (N-term)
    APR07935G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IDH3B (N-term). This antibody is tested and proven to work in the following applications:
    IDH3B Polyclonal Antibody, Biotin Conjugated
    A53683 100 µg
    EUR 570.55
    Description: Ask the seller for details
    IDH3B Polyclonal Antibody, FITC Conjugated
    A53684 100 µg
    EUR 570.55
    Description: The best epigenetics products
    IDH3B Polyclonal Antibody, HRP Conjugated
    A53685 100 µg
    EUR 570.55
    Description: kits suitable for this type of research
    Polyclonal IDH3B Antibody - N-terminal region
    APR07936G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IDH3B - N-terminal region. This antibody is tested and proven to work in the following applications:
    IDH3B Antibody (Biotin)
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    IDH3B Antibody (FITC)
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    IDH3B Antibody (HRP)
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    IDH3B Conjugated Antibody
    C36157 100ul
    EUR 397
    Anti-IDH3B antibody
    STJ115693 100 µl
    EUR 277
    Description: Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the beta subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene.
    Anti-IDH3B antibody
    STJ193071 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to IDH3B
    Idh3B/ Rat Idh3B ELISA Kit
    ELI-43372r 96 Tests
    EUR 886
    Polyclonal IDH3B (aa369-383) Antibody (C-Term)
    APR07933G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IDH3B (aa369-383) (C-Term). This antibody is tested and proven to work in the following applications:
    IDH3B siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    IDH3B siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    YF-PA12530 100 ug
    EUR 403
    Description: Rabbit polyclonal to IDH3B
    IDH3B Antibody, HRP conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    IDH3B Antibody, FITC conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    IDH3B Antibody, Biotin conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    Isocitrate dehydrogenase 3 (NAD+) beta (IDH3B) polyclonal antibody
    ABP-PAB-01173 100 ug Ask for price
      • Product line: Miscellaneous
      • Brand:
    IDH3B Blocking Peptide
    DF8562-BP 1mg
    EUR 195
    IDH3B cloning plasmid
    CSB-CL010992HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1158
    • Sequence: atggcggcattgagcggagtccgctggctgacccgagcgctggtctccgccgggaaccctggggcatggagaggtctgagtacctcggccgcggcgcacgctgcatcgcggagccaggccgaggacgtgagggtggagggctcctttcccgtgaccatgcttccgggagacggtg
    • Show more
    Description: A cloning plasmid for the IDH3B gene.
    Anti-IDH3B (3A10)
    YF-MA13644 100 ug
    EUR 363
    Description: Mouse monoclonal to IDH3B
    Anti-IDH3B (aa369-383) antibody
    STJ72609 100 µg
    EUR 359
    Anti-IDH3B (aa33-46) antibody
    STJ72610 100 µg
    EUR 359
    ELI-43832h 96 Tests
    EUR 824
    Rat IDH3B shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human IDH3B shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Bovine IDH3B ELISA KIT
    ELI-39261b 96 Tests
    EUR 928
    IDH3B Recombinant Protein (Human)
    RP015544 100 ug Ask for price
    IDH3B Recombinant Protein (Rat)
    RP205454 100 ug Ask for price
    IDH3B Recombinant Protein (Mouse)
    RP142901 100 ug Ask for price
    Polyclonal IDH3B (aa33-46) Antibody (internal region, near N-Term)
    APR07932G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IDH3B (aa33-46) (internal region, near N-Term). This antibody is tested and proven to work in the following applications:
    Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody
    abx036108-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Monoclonal IDH3B Antibody (monoclonal) (M01), Clone: 3A10
    APR07934G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human IDH3B (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3A10. This antibody is applicable in E
    Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody
    abx431403-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody
    abx431404-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    Idh3B ORF Vector (Rat) (pORF)
    ORF068486 1.0 ug DNA
    EUR 506
    IDH3B ORF Vector (Human) (pORF)
    ORF005182 1.0 ug DNA
    EUR 95
    Idh3b ORF Vector (Mouse) (pORF)
    ORF047635 1.0 ug DNA
    EUR 506
    Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) ELISA kit
    E04I0425-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) ELISA kit
    E04I0425-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) ELISA kit
    E04I0425-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Idh3B sgRNA CRISPR Lentivector set (Rat)
    K7043801 3 x 1.0 ug
    EUR 339
    Idh3b sgRNA CRISPR Lentivector set (Mouse)
    K3035201 3 x 1.0 ug
    EUR 339
    IDH3B sgRNA CRISPR Lentivector set (Human)
    K1014901 3 x 1.0 ug
    EUR 339
    Idh3B sgRNA CRISPR Lentivector (Rat) (Target 1)
    K7043802 1.0 ug DNA
    EUR 154
    Idh3B sgRNA CRISPR Lentivector (Rat) (Target 2)
    K7043803 1.0 ug DNA
    EUR 154
    Idh3B sgRNA CRISPR Lentivector (Rat) (Target 3)
    K7043804 1.0 ug DNA
    EUR 154
    Idh3b sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K3035202 1.0 ug DNA
    EUR 154
    Idh3b sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3035203 1.0 ug DNA
    EUR 154
    Idh3b sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K3035204 1.0 ug DNA
    EUR 154
    IDH3B sgRNA CRISPR Lentivector (Human) (Target 1)
    K1014902 1.0 ug DNA
    EUR 154
    IDH3B sgRNA CRISPR Lentivector (Human) (Target 2)
    K1014903 1.0 ug DNA
    EUR 154
    IDH3B sgRNA CRISPR Lentivector (Human) (Target 3)
    K1014904 1.0 ug DNA
    EUR 154
    IDH3B Protein Vector (Human) (pPB-C-His)
    PV020725 500 ng
    EUR 329
    IDH3B Protein Vector (Human) (pPB-N-His)
    PV020726 500 ng
    EUR 329
    IDH3B Protein Vector (Human) (pPM-C-HA)
    PV020727 500 ng
    EUR 329
    IDH3B Protein Vector (Human) (pPM-C-His)
    PV020728 500 ng
    EUR 329
    IDH3B Protein Vector (Rat) (pPB-C-His)
    PV273942 500 ng
    EUR 603
    IDH3B Protein Vector (Rat) (pPB-N-His)
    PV273943 500 ng
    EUR 603
    IDH3B Protein Vector (Rat) (pPM-C-HA)
    PV273944 500 ng
    EUR 603
    IDH3B Protein Vector (Rat) (pPM-C-His)
    PV273945 500 ng
    EUR 603
    IDH3B Protein Vector (Mouse) (pPB-C-His)
    PV190538 500 ng
    EUR 603
    IDH3B Protein Vector (Mouse) (pPB-N-His)
    PV190539 500 ng
    EUR 603
    IDH3B Protein Vector (Mouse) (pPM-C-HA)
    PV190540 500 ng
    EUR 603
    IDH3B Protein Vector (Mouse) (pPM-C-His)
    PV190541 500 ng
    EUR 603
    Recombinant Human IDH3B Protein, GST, E.coli-100ug
    QP6193-ec-100ug 100ug
    EUR 408
    Recombinant Human IDH3B Protein, GST, E.coli-10ug
    QP6193-ec-10ug 10ug
    EUR 200
    Recombinant Human IDH3B Protein, GST, E.coli-1mg
    QP6193-ec-1mg 1mg
    EUR 1632
    Recombinant Human IDH3B Protein, GST, E.coli-200ug
    QP6193-ec-200ug 200ug
    EUR 634
    Recombinant Human IDH3B Protein, GST, E.coli-500ug
    QP6193-ec-500ug 500ug
    EUR 1060
    Recombinant Human IDH3B Protein, GST, E.coli-50ug
    QP6193-ec-50ug 50ug
    EUR 263
    Idh3b 3'UTR Luciferase Stable Cell Line
    TU109882 1.0 ml Ask for price
    Idh3B 3'UTR Luciferase Stable Cell Line
    TU206085 1.0 ml Ask for price
    Idh3b 3'UTR GFP Stable Cell Line
    TU159882 1.0 ml Ask for price
    Idh3B 3'UTR GFP Stable Cell Line
    TU256085 1.0 ml Ask for price
    IDH3B 3'UTR GFP Stable Cell Line
    TU060426 1.0 ml
    EUR 1394
    IDH3B 3'UTR Luciferase Stable Cell Line
    TU010426 1.0 ml
    EUR 1394
    Human Isocitrate dehydrogenase [NAD] subunit beta, mitochondrial (IDH3B)
    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 65.8 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Isocitrate dehydrogenase [NAD] subunit beta, mitochondrial(IDH3B) expressed in E.coli
    IDH3B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
    LV675115 1.0 ug DNA
    EUR 682
    IDH3B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
    LV675119 1.0 ug DNA
    EUR 682
    IDH3B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
    LV675120 1.0 ug DNA
    EUR 682
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187
    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252
    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187
    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252
    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187
    mStrawberry Rabbit Polyclonal Antibody
    38083-100ul 100ul
    EUR 252
    mStrawberry Rabbit Polyclonal Antibody
    38083-50ul 50ul
    EUR 187
    AmCyan Rabbit Polyclonal Antibody
    38086-100ul 100ul
    EUR 252
    AmCyan Rabbit Polyclonal Antibody
    38086-50ul 50ul
    EUR 187
    EBFP Rabbit Polyclonal Antibody
    38087-100ul 100ul
    EUR 252
    EBFP Rabbit Polyclonal Antibody
    38087-50ul 50ul
    EUR 187
    Vimentin Rabbit Polyclonal Antibody
    38104-100ul 100ul
    EUR 252
    Vimentin Rabbit Polyclonal Antibody
    38104-50ul 50ul
    EUR 187
    LDHD Rabbit Polyclonal Antibody
    38105-100ul 100ul
    EUR 252
    LDHD Rabbit Polyclonal Antibody
    38105-50ul 50ul
    EUR 187
    GAPDH Rabbit Polyclonal Antibody
    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    IDH3B Rabbit Polyclonal Antibody