HEY1 Rabbit Polyclonal Antibody

HEY1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

HEY1 Polyclonal Antibody
A69347 100 ?g
EUR 628.55
Description: kits suitable for this type of research
HEY1 Polyclonal Antibody
ABP58777-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HEY1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein
HEY1 Polyclonal Antibody
ABP58777-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HEY1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein
HEY1 Polyclonal Antibody
ABP58777-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HEY1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein
HEY1 Polyclonal Antibody
ES11908-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HEY1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
HEY1 Polyclonal Antibody
ES11908-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HEY1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Rabbit Anti Human Hey1 Polyclonal Antibody
CPBT-67678RH 25 µg
EUR 559
HEY1 Rabbit pAb
A16110-100ul 100 ul
EUR 308
HEY1 Rabbit pAb
A16110-200ul 200 ul
EUR 459
HEY1 Rabbit pAb
A16110-20ul 20 ul
EUR 183
HEY1 Rabbit pAb
A16110-50ul 50 ul
EUR 223
HEY1 Polyclonal Conjugated Antibody
C29727 100ul
EUR 397
HEY1 antibody
70R-17727 50 ul
EUR 435
Description: Rabbit polyclonal HEY1 antibody
HEY1 Antibody
1-CSB-PA896909LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500
HEY1 Antibody
DF12076 200ul
EUR 304
Description: HEY1 antibody detects endogenous levels of HEY1.
Hey1 antibody
70R-7932 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Hey1 antibody
HEY1 antibody
70R-5241 50 ug
EUR 467
Description: Rabbit polyclonal HEY1 antibody raised against the middle region of HEY1
HEY1 antibody
70R-5242 50 ug
EUR 467
Description: Rabbit polyclonal HEY1 antibody raised against the N terminal of HEY1
HEY1 Antibody
1-CSB-PA010320GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Polyclonal HEY1 antibody - middle region
APR00803G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - middle region. This antibody is tested and proven to work in the following applications:
HEY1 Polyclonal Antibody, HRP Conjugated
A69348 100 ?g
EUR 628.55
Description: fast delivery possible
HEY1 Polyclonal Antibody, FITC Conjugated
A69349 100 ?g
EUR 628.55
Description: reagents widely cited
HEY1 Polyclonal Antibody, Biotin Conjugated
A69350 100 ?g
EUR 628.55
Description: Ask the seller for details
Polyclonal HEY1 Antibody - C-terminal region
APR00612G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - C-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal HEY1 antibody - N-terminal region
APR00802G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - N-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal HEY1 Antibody - C-terminal region
APR01885G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - C-terminal region. This antibody is tested and proven to work in the following applications:
anti- HEY1 antibody
FNab03849 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: hairy/enhancer-of-split related with YRPW motif 1
  • Uniprot ID: Q9Y5J3
  • Gene ID: 23462
  • Research Area: Cardiovascular, Metabolism, Developmental biology
Description: Antibody raised against HEY1
Anti-HEY1 antibody
PAab03849 100 ug
EUR 355
Anti-HEY1 antibody
STJ118563 100 µl
EUR 277
Anti-HEY1 antibody
STJ193066 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HEY1
HEY1 siRNA
20-abx919305
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pOTB7-HEY1
PVT17696 2 ug
EUR 231
anti-HEY1
YF-PA17897 50 ul
EUR 363
Description: Mouse polyclonal to HEY1
HEY1 Antibody, HRP conjugated
1-CSB-PA896909LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
HEY1 Antibody, FITC conjugated
1-CSB-PA896909LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
HEY1 Antibody, Biotin conjugated
1-CSB-PA896909LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
HEY1 Blocking Peptide
33R-3822 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HEY1 antibody, catalog no. 70R-5241
HEY1 Blocking Peptide
33R-1335 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHST13 antibody, catalog no. 70R-7171
Hey1 Blocking Peptide
33R-9951 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hey1 antibody, catalog no. 70R-7932
HEY1 cloning plasmid
CSB-CL896909HU-10ug 10ug
EUR 366
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 915
  • Sequence: atgaagcgagctcaccccgagtacagctcctcggacagcgagctggacgagaccatcgaggtggagaaggagagtgcggacgagaatggaaacttgagttcggctctaggttccatgtccccaactacatcttcccagattttggccagaaaaagacggagaggaataattgagaa
  • Show more
Description: A cloning plasmid for the HEY1 gene.
HEY1 Blocking Peptide
DF12076-BP 1mg
EUR 195
Anti-HEY1 (3B3)
YF-MA11407 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Anti-HEY1 (2F10)
YF-MA17895 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Anti-HEY1 (1B9)
YF-MA17896 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Anti-HEY1 (3B2)
YF-MA17897 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Anti-HEY1 (1E10)
YF-MA17898 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Anti-HEY1 (1C9)
YF-MA17899 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Anti-HEY1 (4B3)
YF-MA17900 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Anti-HEY1 (3G10)
YF-MA17901 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Anti-HEY1 (1F11)
YF-MA17902 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Anti-HEY1 (3D1)
YF-MA17903 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Anti-HEY1 (3E5)
YF-MA17904 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Anti-HEY1 (4A3)
YF-MA17905 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Anti-HEY1 (3B4)
YF-MA17906 100 ug
EUR 363
Description: Mouse monoclonal to HEY1
Bovine HEY1 ELISA KIT
ELI-13056b 96 Tests
EUR 928
Human HEY1 ELISA KIT
ELI-20889h 96 Tests
EUR 824
Mouse Hey1 ELISA KIT
ELI-08572m 96 Tests
EUR 865
HEY1 ELISA KIT|Human
EF010111 96 Tests
EUR 689
Human HEY1 shRNA Plasmid
20-abx958284
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Canine HEY1 ELISA KIT
ELI-48591d 96 Tests
EUR 928
HEY1 Recombinant Protein (Human)
RP014608 100 ug Ask for price
HEY1 Recombinant Protein (Rat)
RP204491 100 ug Ask for price
HEY1 Recombinant Protein (Mouse)
RP141374 100 ug Ask for price
Monoclonal HEY1 Antibody (monoclonal) (M07), Clone: 4B3
AMM03619G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HEY1 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 4B3. This antibody is applicable in E
Monoclonal HEY1 Antibody (monoclonal) (M09), Clone: 1F11
AMM03620G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HEY1 (monoclonal) (M09). The antibodies are raised in mouse and are from clone 1F11. This antibody is applicable in WB and IF, E
Hey1 ORF Vector (Rat) (pORF)
ORF068165 1.0 ug DNA
EUR 506
HEY1 ORF Vector (Human) (pORF)
ORF004870 1.0 ug DNA
EUR 95
Hey1 ORF Vector (Mouse) (pORF)
ORF047126 1.0 ug DNA
EUR 506
pGEX-4T-1-HEY1 Plasmid
PVTB00542-1a 2 ug
EUR 356
Hey1 sgRNA CRISPR Lentivector set (Rat)
K7084601 3 x 1.0 ug
EUR 339
Hey1 sgRNA CRISPR Lentivector set (Mouse)
K4335501 3 x 1.0 ug
EUR 339
HEY1 sgRNA CRISPR Lentivector set (Human)
K0948201 3 x 1.0 ug
EUR 339
Hey1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7084602 1.0 ug DNA
EUR 154
Hey1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7084603 1.0 ug DNA
EUR 154
Hey1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7084604 1.0 ug DNA
EUR 154
Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4335502 1.0 ug DNA
EUR 154
Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4335503 1.0 ug DNA
EUR 154
Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4335504 1.0 ug DNA
EUR 154
HEY1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0948202 1.0 ug DNA
EUR 154
HEY1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0948203 1.0 ug DNA
EUR 154
HEY1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0948204 1.0 ug DNA
EUR 154
HEY1 Protein Vector (Rat) (pPB-C-His)
PV272658 500 ng
EUR 603
HEY1 Protein Vector (Rat) (pPB-N-His)
PV272659 500 ng
EUR 603
HEY1 Protein Vector (Rat) (pPM-C-HA)
PV272660 500 ng
EUR 603
HEY1 Protein Vector (Rat) (pPM-C-His)
PV272661 500 ng
EUR 603
HEY1 Protein Vector (Mouse) (pPB-C-His)
PV188502 500 ng
EUR 603
HEY1 Protein Vector (Mouse) (pPB-N-His)
PV188503 500 ng
EUR 603
HEY1 Protein Vector (Mouse) (pPM-C-HA)
PV188504 500 ng
EUR 603
HEY1 Protein Vector (Mouse) (pPM-C-His)
PV188505 500 ng
EUR 603
HEY1 Protein Vector (Human) (pPB-C-His)
PV019477 500 ng
EUR 329
HEY1 Protein Vector (Human) (pPB-N-His)
PV019478 500 ng
EUR 329
HEY1 Protein Vector (Human) (pPM-C-HA)
PV019479 500 ng
EUR 329
HEY1 Protein Vector (Human) (pPM-C-His)
PV019480 500 ng
EUR 329
Hey1 3'UTR Luciferase Stable Cell Line
TU109476 1.0 ml Ask for price
Hey1 3'UTR Luciferase Stable Cell Line
TU205746 1.0 ml Ask for price
Hey1 3'UTR GFP Stable Cell Line
TU159476 1.0 ml Ask for price
Hey1 3'UTR GFP Stable Cell Line
TU255746 1.0 ml Ask for price
HEY1 3'UTR GFP Stable Cell Line
TU059745 1.0 ml
EUR 1394
HEY1 3'UTR Luciferase Stable Cell Line
TU009745 1.0 ml
EUR 1394
HEY1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV626575 1.0 ug DNA
EUR 514
HEY1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV626579 1.0 ug DNA
EUR 514
HEY1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV626580 1.0 ug DNA
EUR 514
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

HEY1 Rabbit Polyclonal Antibody