GSTM1 Rabbit Polyclonal Antibody

GSTM1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

GSTM1 Polyclonal Antibody

ABP58729-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GSTM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GSTM1 from Human, Mouse, Rat. This GSTM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM1 protein

GSTM1 Polyclonal Antibody

ABP58729-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GSTM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GSTM1 from Human, Mouse, Rat. This GSTM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM1 protein

GSTM1 Polyclonal Antibody

ABP58729-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GSTM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GSTM1 from Human, Mouse, Rat. This GSTM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM1 protein

GSTM1 Polyclonal Antibody

ES11905-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GSTM1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GSTM1 Polyclonal Antibody

ES11905-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GSTM1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GSTM1 Rabbit pAb

A8819-100ul 100 ul
EUR 308

GSTM1 Rabbit pAb

A8819-200ul 200 ul
EUR 459

GSTM1 Rabbit pAb

A8819-20ul 20 ul Ask for price

GSTM1 Rabbit pAb

A8819-50ul 50 ul Ask for price

GSTM1 Rabbit pAb

A17492-100ul 100 ul
EUR 308

GSTM1 Rabbit pAb

A17492-200ul 200 ul
EUR 459

GSTM1 Rabbit pAb

A17492-20ul 20 ul
EUR 183

GSTM1 Rabbit pAb

A17492-50ul 50 ul
EUR 223

GSTM1 Polyclonal Conjugated Antibody

C30053 100ul
EUR 397

Polyclonal GSTM1 / MU Antibody

AMM05244G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSTM1 / MU . This antibody is tested and proven to work in the following applications:

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit

DLR-GSTm1-Hu-48T 48T
EUR 479
  • Should the Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Mu 1 (GSTm1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit

DLR-GSTm1-Hu-96T 96T
EUR 621
  • Should the Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Mu 1 (GSTm1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit

RDR-GSTm1-Hu-48Tests 48 Tests
EUR 500

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit

RDR-GSTm1-Hu-96Tests 96 Tests
EUR 692

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit

RD-GSTm1-Hu-48Tests 48 Tests
EUR 478

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit

RD-GSTm1-Hu-96Tests 96 Tests
EUR 662

Polyclonal GSTM1 Antibody (C-term)

AMM05246G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSTM1 (C-term). This antibody is tested and proven to work in the following applications:

GSTM1 antibody

23009-100ul 100ul
EUR 390

GSTM1 antibody

70R-17626 50 ul
EUR 435
Description: Rabbit polyclonal GSTM1 antibody

GSTM1 antibody

70R-13538 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GSTM1 antibody

GSTM1 antibody

10R-10423 100 ug
EUR 435
Description: Mouse monoclonal GSTM1 antibody

GSTM1 antibody

70R-49833 100 ul
EUR 244
Description: Purified Polyclonal GSTM1 antibody

GSTM1 antibody

70R-8515 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GSTM1 antibody

GSTM1 antibody

70R-5348 50 ug
EUR 467
Description: Rabbit polyclonal GSTM1 antibody raised against the N terminal of GSTM1

GSTM1 Antibody

BF0243 200ul
EUR 376
Description: GSTM1 antibody detects endogenous levels of total GSTM1.

GSTM1 Antibody

1-CSB-PA009979GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

GSTM1 Antibody

1-CSB-PA009979LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GSTM1 antibody

PAab09906 100 ug
EUR 386

GSTM1 antibody

PAab09966 100 ug
EUR 386

Polyclonal Goat Anti-GSTM1 / GSTM2 Antibody

AMM05005G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GSTM1 / GSTM2 . This antibody is tested and proven to work in the following applications:

Polyclonal GSTM1 antibody - N-terminal region

AMM05248G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSTM1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Mouse GSTM1 Antibody

32935-05111 150 ug
EUR 261

Anti-GSTM1 Antibody

A00569-1 100ug/vial
EUR 294

anti- GSTM1 antibody

FNab03692 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: glutathione S-transferase mu 1
  • Uniprot ID: P09488
  • Gene ID: 2944
  • Research Area: Metabolism
Description: Antibody raised against GSTM1

anti- GSTM1 antibody

FNab09906 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:200
  • Immunogen: glutathione S-transferase mu 1
  • Uniprot ID: P09488
  • Gene ID: 2944
  • Research Area: Metabolism
Description: Antibody raised against GSTM1

anti- GSTM1 antibody

FNab09966 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: glutathione S-transferase mu 1
  • Uniprot ID: P09488
  • Gene ID: 2944
  • Research Area: Metabolism
Description: Antibody raised against GSTM1

anti- GSTM1 antibody

LSMab09906 100 ug
EUR 386

anti- GSTM1 antibody

LSMab09966 100 ug
EUR 386

Anti-GSTM1 antibody

PAab03692 100 ug
EUR 386

Anti-GSTM1 antibody

STJ111433 100 µl
EUR 277
Description: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene.

Anti-GSTM1 antibody

STJ119590 100 µl
EUR 277
Description: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]

Anti-GSTM1 antibody

STJ193063 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GSTM1

Gstm1/ Rat Gstm1 ELISA Kit

ELI-48471r 96 Tests
EUR 886

GSTM1 protein

30R-1261 100 ug
EUR 300
Description: Purified recombinant Mouse GSTM1 protein

GSTM1 siRNA

20-abx902353
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSTM1 siRNA

20-abx918818
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSTM1 siRNA

20-abx918819
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSTM1 Antibody, HRP conjugated

1-CSB-PA009979LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GSTM1 Antibody, FITC conjugated

1-CSB-PA009979LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GSTM1 Antibody, Biotin conjugated

1-CSB-PA009979LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-GSTM1 / GSTM2 antibody

STJ70642 100 µg
EUR 359

GSTM1 Blocking Peptide

33R-4498 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSTM1 antibody, catalog no. 70R-5348

GSTM1 Blocking Peptide

33R-7049 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSTM1 antibody, catalog no. 70R-8515

GSTM1 Blocking Peptide

20-abx062708
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GSTM1 Blocking Peptide

BF0243-BP 1mg
EUR 195

GSTM1 cloning plasmid

CSB-CL009979HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 546
  • Sequence: atgcccatgatactggggtactgggacatccgcgggctggcccacgccatccgcctgctcctggaatacacagactcaagctatgaggaaaagaagtacacgatgggggacgctcctgattatgacagaagccagtggctgaatgaaaaattcaagctgggcctggactttcccaa
  • Show more
Description: A cloning plasmid for the GSTM1 gene.

anti-GSTM1 (1H4A4)

LF-MA30658 100 ul
EUR 527
Description: Mouse Monoclonal to GSTM1

anti-GSTM1 (1H4F2)

LF-MA30659 100 ul
EUR 527
Description: Mouse Monoclonal to GSTM1

Anti-GSTM1 (3B10)

YF-MA13347 100 ug
EUR 363
Description: Mouse monoclonal to GSTM1

Mouse GSTM1 Antibody (Biotin Conjugate)

32935-05121 150 ug
EUR 369

Monoclonal GSTM1 Antibody, Clone: 1H4F2

APR16645G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GSTM1. The antibodies are raised in Mouse and are from clone 1H4F2. This antibody is applicable in WB and IHC, FC, E

Anti-GSTM1 Antibody (monoclonal, 11F2)

M00569 100ug/vial
EUR 334

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken)

4-PAA658Ga01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1)

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse)

4-PAA658Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1)

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat)

4-PAA658Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1)

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), APC

4-PAA658Ga01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), Biotinylated

4-PAA658Ga01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), Cy3

4-PAA658Ga01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), FITC

4-PAA658Ga01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), HRP

4-PAA658Ga01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), PE

4-PAA658Ga01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), APC

4-PAA658Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), Biotinylated

4-PAA658Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), Cy3

4-PAA658Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), FITC

4-PAA658Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), HRP

4-PAA658Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), PE

4-PAA658Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), APC

4-PAA658Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), Biotinylated

4-PAA658Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), Cy3

4-PAA658Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), FITC

4-PAA658Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), HRP

4-PAA658Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), PE

4-PAA658Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE.

Mouse GSTM1 AssayLite Antibody (FITC Conjugate)

32935-05141 150 ug
EUR 428

Mouse GSTM1 AssayLite Antibody (APC Conjugate)

32935-05151 150 ug
EUR 428

Mouse GSTM1 AssayLite Antibody (RPE Conjugate)

32935-05161 150 ug
EUR 428

Mouse GSTM1 AssayLite Antibody (PerCP Conjugate)

32935-05171 150 ug
EUR 471

GSTM1 protein (His tag)

80R-3744 50 ug
EUR 327
Description: Purified recombinant GSTM1 protein (His tag)

GSTM1 ELISA KIT|Human

EF010014 96 Tests
EUR 689

Rat GSTM1 shRNA Plasmid

20-abx984488
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GSTM1 shRNA Plasmid

20-abx951990
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GSTM1 shRNA Plasmid

20-abx970689
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GSTM1 Recombinant Protein (Human)

RP014125 100 ug Ask for price

GSTM1 Recombinant Protein (Rat)

RP203849 100 ug Ask for price

GSTM1 Recombinant Protein (Mouse)

RP140252 100 ug Ask for price

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), APC-Cy7

4-PAA658Ga01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat)

4-PAA658Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1)

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAA658Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), APC-Cy7

4-PAA658Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

20-abx009184
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

abx010622-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

GSTM1 Rabbit Polyclonal Antibody