GPR4 Rabbit Polyclonal Antibody

GPR4 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    GPR4 Polyclonal Antibody
    ES11473-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against GPR4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    GPR4 Polyclonal Antibody
    ES11473-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against GPR4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    GPR4 Rabbit pAb
    A15998-100ul 100 ul
    EUR 308
    GPR4 Rabbit pAb
    A15998-200ul 200 ul
    EUR 459
    GPR4 Rabbit pAb
    A15998-20ul 20 ul
    EUR 183
    GPR4 Rabbit pAb
    A15998-50ul 50 ul
    EUR 223
    Polyclonal GPR4 Antibody (Center)
    APR16567G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR4 (Center). This antibody is tested and proven to work in the following applications:
    GPR4 antibody
    70R-13653 100 ul
    EUR 430
    Description: Affinity purified Rabbit polyclonal GPR4 antibody
    GPR4 Antibody
    44927-100ul 100ul
    EUR 252
    GPR4 Antibody
    44927-50ul 50ul
    EUR 187
    GPR4 Antibody
    DF2744 200ul
    EUR 304
    Description: GPR4 antibody detects endogenous levels of total GPR4.
    GPR4 Antibody
    DF2806 200ul
    EUR 304
    Description: GPR4 antibody detects endogenous levels of total GPR4.
    GPR4 Antibody
    1-CSB-PA009813LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against GPR4. Recognizes GPR4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
    GPR4 Antibody
    ABD2744 100 ug
    EUR 438
    GPR4 Antibody
    ABD2806 100 ug
    EUR 438
    Polyclonal GPR4 Antibody (C-Terminus)
    APR16566G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR4 (C-Terminus). This antibody is tested and proven to work in the following applications:
    Polyclonal GPR4 Antibody (Cytoplasmic Domain)
    APR16568G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR4 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
    Polyclonal GPR4 Antibody (Extracellular Domain)
    APR16569G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR4 (Extracellular Domain). This antibody is tested and proven to work in the following applications:
    GPR4 Conjugated Antibody
    C44927 100ul
    EUR 397
    Anti-GPR4 antibody
    STJ118457 100 µl
    EUR 277
    Anti-GPR4 antibody
    STJ192631 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to GPR4
    Gpr4/ Rat Gpr4 ELISA Kit
    ELI-47253r 96 Tests
    EUR 886
    GPR4 siRNA
    20-abx902287
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    GPR4 siRNA
    20-abx918529
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    GPR4 siRNA
    20-abx918530
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    GPR4 Antibody, HRP conjugated
    1-CSB-PA009813LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against GPR4. Recognizes GPR4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    GPR4 Antibody, FITC conjugated
    1-CSB-PA009813LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against GPR4. Recognizes GPR4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    GPR4 Antibody, Biotin conjugated
    1-CSB-PA009813LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against GPR4. Recognizes GPR4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    G protein-coupled receptor 4 (GPR4) polyclonal antibody
    ABP-PAB-P0010 100 ug Ask for price
      • Product line: Cell Surface Molecules / GPCRs
      • Brand:
    GPR4 Blocking Peptide
    DF2744-BP 1mg
    EUR 195
    GPR4 Blocking Peptide
    DF2806-BP 1mg
    EUR 195
    GPR4 cloning plasmid
    CSB-CL009813HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1089
    • Sequence: atgggcaaccacacgtgggagggctgccacgtggactcgcgcgtggaccacctctttccgccatccctctacatctttgtcatcggcgtggggctgcccaccaactgcctggctctgtgggcggcctaccgccaggtgcaacagcgcaacgagctgggcgtctacctgatgaacc
    • Show more
    Description: A cloning plasmid for the GPR4 gene.
    Rat GPR4 shRNA Plasmid
    20-abx989484
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human GPR4 shRNA Plasmid
    20-abx951893
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse GPR4 shRNA Plasmid
    20-abx983255
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    GPR4 Recombinant Protein (Human)
    RP013861 100 ug Ask for price
    GPR4 Recombinant Protein (Rat)
    RP203432 100 ug Ask for price
    GPR4 Recombinant Protein (Mouse)
    RP139646 100 ug Ask for price

    GPR4 Rabbit Polyclonal Antibody