GPR4 Rabbit Polyclonal Antibody

GPR4 Rabbit Polyclonal Antibody

Contact Us Below To Order :

GPR4 Polyclonal Antibody
ABP58691-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GPR4 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR4 from Human, Mouse, Rat. This GPR4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR4 protein at amino acid sequence of 160-240
GPR4 Polyclonal Antibody
ABP58691-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GPR4 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR4 from Human, Mouse, Rat. This GPR4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR4 protein at amino acid sequence of 160-240
GPR4 Rabbit pAb
A15998-100ul 100 ul
EUR 308
GPR4 Rabbit pAb
A15998-200ul 200 ul
EUR 459
GPR4 Rabbit pAb
A15998-20ul 20 ul
EUR 183
GPR4 Rabbit pAb
A15998-50ul 50 ul
EUR 223
Polyclonal GPR4 Antibody (Center)
APR16567G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR4 (Center). This antibody is tested and proven to work in the following applications:
GPR4 Antibody
ABD2744 100 ug
EUR 438
GPR4 Antibody
ABD2806 100 ug
EUR 438
GPR4 Antibody
44927-100ul 100ul
EUR 252
GPR4 Antibody
44927-50ul 50ul
EUR 187
GPR4 antibody
70R-13653 100 ul
EUR 430
Description: Affinity purified Rabbit polyclonal GPR4 antibody
GPR4 Antibody
DF2744 200ul
EUR 304
Description: GPR4 antibody detects endogenous levels of total GPR4.
GPR4 Antibody
DF2806 200ul
EUR 304
Description: GPR4 antibody detects endogenous levels of total GPR4.
GPR4 Antibody
1-CSB-PA009813LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR4. Recognizes GPR4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
Polyclonal GPR4 Antibody (C-Terminus)
APR16566G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR4 (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal GPR4 Antibody (Cytoplasmic Domain)
APR16568G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR4 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal GPR4 Antibody (Extracellular Domain)
APR16569G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR4 (Extracellular Domain). This antibody is tested and proven to work in the following applications:
Gpr4/ Rat Gpr4 ELISA Kit
ELI-47253r 96 Tests
EUR 886
GPR4 Conjugated Antibody
C44927 100ul
EUR 397
Anti-GPR4 antibody
STJ118457 100 µl
EUR 277
Anti-GPR4 antibody
STJ192631 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPR4
GPR4 siRNA
20-abx902287
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR4 siRNA
20-abx918529
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR4 siRNA
20-abx918530
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR4 Antibody, HRP conjugated
1-CSB-PA009813LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR4. Recognizes GPR4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
GPR4 Antibody, FITC conjugated
1-CSB-PA009813LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR4. Recognizes GPR4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
GPR4 Antibody, Biotin conjugated
1-CSB-PA009813LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR4. Recognizes GPR4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
G protein-coupled receptor 4 (GPR4) polyclonal antibody
ABP-PAB-P0010 100 ug Ask for price
    • Product line: Cell Surface Molecules / GPCRs
    • Brand:
GPR4 cloning plasmid
CSB-CL009813HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1089
  • Sequence: atgggcaaccacacgtgggagggctgccacgtggactcgcgcgtggaccacctctttccgccatccctctacatctttgtcatcggcgtggggctgcccaccaactgcctggctctgtgggcggcctaccgccaggtgcaacagcgcaacgagctgggcgtctacctgatgaacc
  • Show more
Description: A cloning plasmid for the GPR4 gene.
GPR4 Blocking Peptide
DF2744-BP 1mg
EUR 195
GPR4 Blocking Peptide
DF2806-BP 1mg
EUR 195
Rat GPR4 shRNA Plasmid
20-abx989484
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GPR4 shRNA Plasmid
20-abx983255
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GPR4 shRNA Plasmid
20-abx951893
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GPR4 Recombinant Protein (Human)
RP013861 100 ug Ask for price
GPR4 Recombinant Protein (Rat)
RP203432 100 ug Ask for price
GPR4 Recombinant Protein (Mouse)
RP139646 100 ug Ask for price

GPR4 Rabbit Polyclonal Antibody