GNB1L Rabbit Polyclonal Antibody

GNB1L Rabbit Polyclonal Antibody

Contact Us Below To Order :

GNB1L Polyclonal Antibody
ABP58656-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GNB1L protein
  • Applications tips:
Description: A polyclonal antibody for detection of GNB1L from Human, Mouse. This GNB1L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNB1L protein
GNB1L Polyclonal Antibody
ES11904-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GNB1L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
GNB1L Polyclonal Antibody
ES11904-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GNB1L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
GNB1L Rabbit pAb
A7810-100ul 100 ul
EUR 308
GNB1L Rabbit pAb
A7810-200ul 200 ul
EUR 459
GNB1L Rabbit pAb
A7810-20ul 20 ul
EUR 183
GNB1L Rabbit pAb
A7810-50ul 50 ul
EUR 223
GNB1L antibody
70R-1642 100 ug
EUR 377
Description: Rabbit polyclonal GNB1L antibody
GNB1L Antibody
47128-100ul 100ul
EUR 252
GNB1L Antibody
1-CSB-PA866315ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNB1L. Recognizes GNB1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
GNB1L Antibody
1-CSB-PA866315ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNB1L. Recognizes GNB1L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
GNB1L Conjugated Antibody
C47128 100ul
EUR 397
Anti-GNB1L antibody
STJ110120 100 µl
EUR 277
Description: This gene encodes a G-protein beta-subunit-like polypeptide which is a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 6 WD repeats and is highly expressed in the heart. The gene maps to the region on chromosome 22q11, which is deleted in DiGeorge syndrome, trisomic in derivative 22 syndrome and tetrasomic in cat-eye syndrome. Therefore, this gene may contribute to the etiology of those disorders. Transcripts from this gene share exons with some transcripts from the C22orf29 gene.
Anti-GNB1L antibody
STJ193062 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GNB1L
GNB1L siRNA
20-abx918170
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GNB1L siRNA
20-abx918171
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GNB1L Blocking Peptide
33R-8245 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNB1L antibody, catalog no. 70R-1642
GNB1L cloning plasmid
CSB-CL866315HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 984
  • Sequence: atgacggccccctgcccgccgccacctccagacccccagtttgtcctccgaggcacccagtcaccggtgcatgcgctgcacttctgcgaaggagcccaggctcaggggcgcccgctcctcttctcagggtctcagagtggcctggtacacatctggagcctgcagacgcggagagc
  • Show more
Description: A cloning plasmid for the GNB1L gene.
pENTR223-GNB1L vector
PVT11722 2 ug
EUR 304
Mouse Gnb1l ELISA KIT
ELI-09738m 96 Tests
EUR 865
Human GNB1L ELISA KIT
ELI-27253h 96 Tests
EUR 824
Human GNB1L shRNA Plasmid
20-abx960145
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GNB1L shRNA Plasmid
20-abx970227
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pECMV-3-FLAG-GNB1L
PVT13573 2 ug
EUR 599
GNB1L Recombinant Protein (Human)
RP013507 100 ug Ask for price
GNB1L Recombinant Protein (Mouse)
RP138965 100 ug Ask for price
GNB1L Recombinant Protein (Mouse)
RP138968 100 ug Ask for price
GNB1L ORF Vector (Human) (pORF)
ORF004503 1.0 ug DNA
EUR 95
Gnb1l ORF Vector (Mouse) (pORF)
ORF046323 1.0 ug DNA
EUR 506
Gnb1l ORF Vector (Mouse) (pORF)
ORF046324 1.0 ug DNA
EUR 506
Gnb1l sgRNA CRISPR Lentivector set (Mouse)
K4819201 3 x 1.0 ug
EUR 339
GNB1L sgRNA CRISPR Lentivector set (Human)
K0876001 3 x 1.0 ug
EUR 339
Gnb1l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4819202 1.0 ug DNA
EUR 154
Gnb1l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4819203 1.0 ug DNA
EUR 154
Gnb1l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4819204 1.0 ug DNA
EUR 154
GNB1L sgRNA CRISPR Lentivector (Human) (Target 1)
K0876002 1.0 ug DNA
EUR 154
GNB1L sgRNA CRISPR Lentivector (Human) (Target 2)
K0876003 1.0 ug DNA
EUR 154
GNB1L sgRNA CRISPR Lentivector (Human) (Target 3)
K0876004 1.0 ug DNA
EUR 154
GNB1L Protein Vector (Mouse) (pPB-C-His)
PV185290 500 ng
EUR 603
GNB1L Protein Vector (Mouse) (pPB-N-His)
PV185291 500 ng
EUR 603
GNB1L Protein Vector (Mouse) (pPM-C-HA)
PV185292 500 ng
EUR 603
GNB1L Protein Vector (Mouse) (pPM-C-His)
PV185293 500 ng
EUR 603
GNB1L Protein Vector (Mouse) (pPB-C-His)
PV185294 500 ng
EUR 603
GNB1L Protein Vector (Mouse) (pPB-N-His)
PV185295 500 ng
EUR 603
GNB1L Protein Vector (Mouse) (pPM-C-HA)
PV185296 500 ng
EUR 603
GNB1L Protein Vector (Mouse) (pPM-C-His)
PV185297 500 ng
EUR 603
GNB1L Protein Vector (Human) (pPB-C-His)
PV018009 500 ng
EUR 329
GNB1L Protein Vector (Human) (pPB-N-His)
PV018010 500 ng
EUR 329
GNB1L Protein Vector (Human) (pPM-C-HA)
PV018011 500 ng
EUR 329
GNB1L Protein Vector (Human) (pPM-C-His)
PV018012 500 ng
EUR 329
Recombinant Human GNB1L Protein, GST, E.coli-100ug
QP8085-ec-100ug 100ug
EUR 571
Recombinant Human GNB1L Protein, GST, E.coli-10ug
QP8085-ec-10ug 10ug
EUR 272
Recombinant Human GNB1L Protein, GST, E.coli-1mg
QP8085-ec-1mg 1mg
EUR 2303
Recombinant Human GNB1L Protein, GST, E.coli-200ug
QP8085-ec-200ug 200ug
EUR 898
Recombinant Human GNB1L Protein, GST, E.coli-500ug
QP8085-ec-500ug 500ug
EUR 1514
Recombinant Human GNB1L Protein, GST, E.coli-50ug
QP8085-ec-50ug 50ug
EUR 362
Gnb1l 3'UTR Luciferase Stable Cell Line
TU108858 1.0 ml Ask for price
Gnb1l 3'UTR Luciferase Stable Cell Line
TU205217 1.0 ml Ask for price
Gnb1l 3'UTR GFP Stable Cell Line
TU158858 1.0 ml Ask for price
Gnb1l 3'UTR GFP Stable Cell Line
TU255217 1.0 ml Ask for price
GNB1L 3'UTR GFP Stable Cell Line
TU058984 1.0 ml
EUR 4617
GNB1L 3'UTR Luciferase Stable Cell Line
TU008984 1.0 ml
EUR 4617
Guanine Nucleotide-Binding Protein Subunit Beta-Like Protein 1 (GNB1L) Antibody
20-abx006541
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Nucleotide-Binding Protein Subunit Beta-Like Protein 1 (GNB1L) Antibody
20-abx321945
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Nucleotide-Binding Protein Subunit Beta-Like Protein 1 (GNB1L) Antibody
20-abx322540
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

GNB1L Rabbit Polyclonal Antibody