GPR39 Rabbit Polyclonal Antibody

GPR39 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    GPR39 Polyclonal Antibody

    ABP58690-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human GPR39 protein at amino acid sequence of 140-220
    • Applications tips:
    Description: A polyclonal antibody for detection of GPR39 from Human. This GPR39 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR39 protein at amino acid sequence of 140-220

    GPR39 Polyclonal Antibody

    ABP58690-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human GPR39 protein at amino acid sequence of 140-220
    • Applications tips:
    Description: A polyclonal antibody for detection of GPR39 from Human. This GPR39 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR39 protein at amino acid sequence of 140-220

    GPR39 Polyclonal Antibody

    ABP58690-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human GPR39 protein at amino acid sequence of 140-220
    • Applications tips:
    Description: A polyclonal antibody for detection of GPR39 from Human. This GPR39 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR39 protein at amino acid sequence of 140-220

    GPR39 Antibody

    ABD2743 100 ug
    EUR 438

    GPR39 Antibody

    ABD2805 100 ug
    EUR 438

    GPR39 Antibody

    37607-100ul 100ul
    EUR 252

    GPR39 Antibody

    DF2743 200ul
    EUR 304
    Description: GPR39 antibody detects endogenous levels of total GPR39.

    GPR39 Antibody

    DF2805 200ul
    EUR 304
    Description: GPR39 antibody detects endogenous levels of total GPR39.

    GPR39 Antibody

    1-CSB-PA009812LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against GPR39. Recognizes GPR39 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:200-1:500

    GPR39 Antibody

    1-CSB-PA034253
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against GPR39. Recognizes GPR39 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

    Polyclonal GPR39 Antibody (C-term)

    AMM08585G 0.1ml
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR39 (C-term). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR39 Antibody (C-Terminus)

    APR16561G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR39 (C-Terminus). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR39 Antibody (C-Terminus)

    APR16562G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR39 (C-Terminus). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR39 Antibody (C-Terminus)

    APR16563G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR39 (C-Terminus). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR39 Antibody (Extracellular Domain)

    APR16564G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR39 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR39 Antibody (internal region)

    APR16565G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GPR39 (internal region). This antibody is tested and proven to work in the following applications:

    GPR39 Conjugated Antibody

    C37607 100ul
    EUR 397

    Anti-GPR39 antibody

    STJ192630 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to GPR39

    GPR39 siRNA

    20-abx918524
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Polyclonal Goat Anti-GPR39 Antibody (internal region)

    APR16283G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR39 (internal region). This antibody is tested and proven to work in the following applications:

    GPR39 Antibody, HRP conjugated

    1-CSB-PA009812LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against GPR39. Recognizes GPR39 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    GPR39 Antibody, FITC conjugated

    1-CSB-PA009812LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against GPR39. Recognizes GPR39 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    GPR39 Antibody, Biotin conjugated

    1-CSB-PA009812LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against GPR39. Recognizes GPR39 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    GPR39 cloning plasmid

    CSB-CL009812HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1362
    • Sequence: ATGGCTTCACCCAGCCTCCCGGGCAGTGACTGCTCCCAAATCATTGATCACAGTCATGTCCCCGAGTTTGAGGTGGCCACCTGGATCAAAATCACCCTTATTCTGGTGTACCTGATCATCTTCGTGATGGGCCTTCTGGGGAACAGCGCCACCATTCGGGTCACCCAGGTGCTGC
    • Show more
    Description: A cloning plasmid for the GPR39 gene.

    GPR39 Blocking Peptide

    DF2743-BP 1mg
    EUR 195

    GPR39 Blocking Peptide

    DF2805-BP 1mg
    EUR 195

    Anti-GPR39 (aa377-391) antibody

    STJ73166 100 µg
    EUR 359

    Rabbit Anti-Mouse GPR39 IgG #1 aff pure

    GPR391-A 100 ug
    EUR 482

    Rabbit Anti-Mouse GPR39 peptide (NT) antiserum #1

    GPR391-S 100 ul
    EUR 457

    Rabbit Anti-Human GPR39 peptide (NT) antiserum #2

    GPR392-S 100 ul
    EUR 457

    Human GPR39 shRNA Plasmid

    20-abx951922
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    GPR39 Recombinant Protein (Human)

    RP039580 100 ug Ask for price

    GPR39 Recombinant Protein (Rat)

    RP203426 100 ug Ask for price

    GPR39 Recombinant Protein (Rat)

    RP203429 100 ug Ask for price

    GPR39 Recombinant Protein (Mouse)

    RP139643 100 ug Ask for price

    Rabbit G protein coupled receptor 39(GPR39) ELISA kit

    E04G0438-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit G protein coupled receptor 39(GPR39) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    GPR39 Rabbit Polyclonal Antibody