DTL Rabbit Polyclonal Antibody

DTL Rabbit Polyclonal Antibody

Contact Us Below To Order :

DTL Polyclonal Antibody

ABP58429-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DTL protein
  • Applications tips:
Description: A polyclonal antibody for detection of DTL from Human, Mouse. This DTL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DTL protein

DTL Polyclonal Antibody

ES11892-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DTL from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DTL Polyclonal Antibody

ES11892-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DTL from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DTL Rabbit pAb

A12150-100ul 100 ul
EUR 308

DTL Rabbit pAb

A12150-200ul 200 ul
EUR 459

DTL Rabbit pAb

A12150-20ul 20 ul
EUR 183

DTL Rabbit pAb

A12150-50ul 50 ul
EUR 223

Polyclonal DTL Antibody (Center)

APR03505G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DTL (Center). This antibody is tested and proven to work in the following applications:

DTL antibody

70R-16943 50 ul
EUR 435
Description: Rabbit polyclonal DTL antibody

DTL antibody

70R-2405 50 ug
EUR 467
Description: Rabbit polyclonal DTL antibody

DTL Antibody

46556-100ul 100ul
EUR 252

DTL Antibody

1-CSB-PA889160LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DTL. Recognizes DTL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DTL Antibody

abx122413-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

DTL Antibody

1-CSB-PA007215GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DTL. Recognizes DTL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DTL Antibody

abx232549-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

DTL Conjugated Antibody

C46556 100ul
EUR 397

DTL Antibody (HRP)

20-abx315547
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DTL Antibody (FITC)

20-abx315548
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DTL Antibody (Biotin)

20-abx315549
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

anti- DTL antibody

FNab02549 100µg
EUR 505.25
  • Immunogen: denticleless homolog(Drosophila)
  • Uniprot ID: Q9NZJ0
  • Gene ID: 51514
  • Research Area: Cell Division and Proliferation, Metabolism
Description: Antibody raised against DTL

Anti-DTL antibody

PAab02549 100 ug
EUR 355

Anti-DTL antibody

STJ114043 100 µl
EUR 277

Anti-DTL antibody

STJ193050 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DTL

DTL siRNA

20-abx914682
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DTL siRNA

20-abx914683
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DTL

YF-PA19093 100 ug
EUR 403
Description: Rabbit polyclonal to DTL

DTL Antibody, HRP conjugated

1-CSB-PA889160LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DTL. Recognizes DTL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DTL Antibody, FITC conjugated

1-CSB-PA889160LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DTL. Recognizes DTL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DTL Antibody, Biotin conjugated

1-CSB-PA889160LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DTL. Recognizes DTL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DTL Blocking Peptide

33R-9712 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DTL antibody, catalog no. 70R-2405

DTL cloning plasmid

CSB-CL889160HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2193
  • Sequence: atgctcttcaattcggtgctccgccagccccagcttggcgtcctgagaaatggatggtcttcacaataccctcttcaatcccttctgactggttatcagtgcagtggtaatgatgaacacacttcttatggagaaacaggagtcccagttcctccttttggatgtaccttctctt
  • Show more
Description: A cloning plasmid for the DTL gene.

DTL cloning plasmid

CSB-CL889160HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2193
  • Sequence: atgctcttcaattcggtgctccgccagccccagcttggcgtcctgagaaatggatggtcttcacaataccctcttcaatcccttctgactggttatcagtgcagtggtaatgatgaacacacttcttatggagaaacaggagtcccagttcctccttttggatgtaccttctctt
  • Show more
Description: A cloning plasmid for the DTL gene.

Denticleless Protein Homolog (DTL) Antibody

abx026016-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Denticleless Protein Homolog (DTL) Antibody

abx026016-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Denticleless Homolog (Drosophila) (DTL) Antibody

20-abx112037
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Denticleless Protein Homolog (DTL) Antibody

20-abx125788
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Denticleless Protein Homolog (DTL) Antibody

20-abx301818
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DTL ELISA KIT|Human

EF009228 96 Tests
EUR 689

Mouse DTL shRNA Plasmid

20-abx978699
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DTL shRNA Plasmid

20-abx959804
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pIRES2-EGFP-DTL Plasmid

PVTB00624-2a 2 ug
EUR 356

pCMV-SPORT6-DTL Plasmid

PVT16145 2 ug
EUR 325

DTL Recombinant Protein (Human)

RP009871 100 ug Ask for price

DTL Recombinant Protein (Human)

RP009874 100 ug Ask for price

DTL Recombinant Protein (Mouse)

RP130154 100 ug Ask for price

DTL ORF Vector (Human) (pORF)

ORF003291 1.0 ug DNA
EUR 95

DTL ORF Vector (Human) (pORF)

ORF003292 1.0 ug DNA
EUR 95

Dtl ORF Vector (Mouse) (pORF)

ORF043386 1.0 ug DNA
EUR 506

DTL sgRNA CRISPR Lentivector set (Human)

K0635501 3 x 1.0 ug
EUR 339

Dtl sgRNA CRISPR Lentivector set (Mouse)

K4702501 3 x 1.0 ug
EUR 339

Mouse Sarcoma antigen S35, Dtl ELISA KIT

ELI-29540m 96 Tests
EUR 865

Human Denticleless protein homolog, DTL ELISA KIT

ELI-26129h 96 Tests
EUR 824

Chicken Denticleless protein homolog, DTL ELISA KIT

ELI-26661c 96 Tests
EUR 928

Mouse Denticleless protein homolog, Dtl ELISA KIT

ELI-26662m 96 Tests
EUR 865

DTL sgRNA CRISPR Lentivector (Human) (Target 1)

K0635502 1.0 ug DNA
EUR 154

DTL sgRNA CRISPR Lentivector (Human) (Target 2)

K0635503 1.0 ug DNA
EUR 154

DTL sgRNA CRISPR Lentivector (Human) (Target 3)

K0635504 1.0 ug DNA
EUR 154

Dtl sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4702502 1.0 ug DNA
EUR 154

Dtl sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4702503 1.0 ug DNA
EUR 154

Dtl sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4702504 1.0 ug DNA
EUR 154

DTL Protein Vector (Mouse) (pPB-C-His)

PV173542 500 ng
EUR 1065

DTL Protein Vector (Mouse) (pPB-N-His)

PV173543 500 ng
EUR 1065

DTL Protein Vector (Mouse) (pPM-C-HA)

PV173544 500 ng
EUR 1065

DTL Protein Vector (Mouse) (pPM-C-His)

PV173545 500 ng
EUR 1065

DTL Protein Vector (Human) (pPB-C-His)

PV013161 500 ng
EUR 329

DTL Protein Vector (Human) (pPB-N-His)

PV013162 500 ng
EUR 329

DTL Protein Vector (Human) (pPM-C-HA)

PV013163 500 ng
EUR 329

DTL Protein Vector (Human) (pPM-C-His)

PV013164 500 ng
EUR 329

DTL Protein Vector (Human) (pPB-C-His)

PV013165 500 ng
EUR 329

DTL Protein Vector (Human) (pPB-N-His)

PV013166 500 ng
EUR 329

DTL Protein Vector (Human) (pPM-C-HA)

PV013167 500 ng
EUR 329

DTL Protein Vector (Human) (pPM-C-His)

PV013168 500 ng
EUR 329

Dtl 3'UTR GFP Stable Cell Line

TU155419 1.0 ml Ask for price

Dtl 3'UTR Luciferase Stable Cell Line

TU105419 1.0 ml Ask for price

Dtl 3'UTR Luciferase Stable Cell Line

TU203661 1.0 ml Ask for price

Dtl 3'UTR GFP Stable Cell Line

TU253661 1.0 ml Ask for price

DTL 3'UTR GFP Stable Cell Line

TU056357 1.0 ml
EUR 1521

DTL 3'UTR Luciferase Stable Cell Line

TU006357 1.0 ml
EUR 1521

DTL Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV709467 1.0 ug DNA
EUR 316

DTL Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV709471 1.0 ug DNA
EUR 316

DTL Rabbit Polyclonal Antibody