TAF9 Rabbit Polyclonal Antibody

TAF9 Rabbit Polyclonal Antibody

Contact Us Below To Order :

TAF9 Polyclonal Antibody

ABP60614-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TAF9 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TAF9 from Human, Mouse, Rat. This TAF9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TAF9 protein

TAF9 Rabbit pAb

A2021-100ul 100 ul
EUR 308

TAF9 Rabbit pAb

A2021-200ul 200 ul
EUR 459

TAF9 Rabbit pAb

A2021-20ul 20 ul
EUR 183

TAF9 Rabbit pAb

A2021-50ul 50 ul
EUR 223

TAF9 antibody

70R-20696 50 ul
EUR 435
Description: Rabbit polyclonal TAF9 antibody

TAF9 antibody

70R-8040 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TAF9 antibody

TAF9 Antibody

ABD6757 100 ug
EUR 438

TAF9 Antibody

32554-100ul 100ul
EUR 252

TAF9 Antibody

DF6757 200ul
EUR 304
Description: TAF9 Antibody detects endogenous levels of total TAF9.

TAF9 Antibody

1-CSB-PA619078ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TAF9. Recognizes TAF9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

TAF9 Antibody

1-CSB-PA023100GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TAF9. Recognizes TAF9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TAF9 Conjugated Antibody

C32554 100ul
EUR 397

anti- TAF9 antibody

FNab08489 100µg
EUR 548.75
  • Immunogen: TAF9 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 32kDa
  • Uniprot ID: Q16594
  • Gene ID: 6880
  • Research Area: Metabolism
Description: Antibody raised against TAF9

Human TAF9 Antibody

32211-05111 150 ug
EUR 261

Anti-TAF9 antibody

PAab08489 100 ug
EUR 386

Anti-TAF9 antibody

STJ25772 100 µl
EUR 277
Description: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the smaller subunits of TFIID that binds to the basal transcription factor GTF2B as well as to several transcriptional activators such as p53 and VP16. In human, TAF9 and AK6 (GeneID: 102157402) are two distinct genes that share 5' exons. A similar but distinct gene (TAF9L) has been found on the X chromosome and a pseudogene has been identified on chromosome 19. Alternative splicing results in multiple transcript variants.

Anti-TAF9 antibody

STJ193048 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TAF9

Taf9/ Rat Taf9 ELISA Kit

ELI-53088r 96 Tests
EUR 886

Taf9/ Rat Taf9 ELISA Kit

ELI-42939r 96 Tests
EUR 886

TAF9 siRNA

20-abx905447
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TAF9 siRNA

20-abx935993
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TAF9 siRNA

20-abx935994
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-TAF9

PVT12668 2 ug
EUR 391

TAF9 Blocking Peptide

33R-3402 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TAF9 antibody, catalog no. 70R-8040

TAF9 Blocking Peptide

DF6757-BP 1mg
EUR 195

TAF9 cloning plasmid

CSB-CL619078HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atgttgcttccgaacatcctgctcaccggtacaccaggggttggaaaaaccacactaggcaaagaacttgcgtcaaaatcaggactgaaatacattaatgtgggtgatttagctcgagaagagcaattgtatgatggctatgatgaagagtatgactgtcccattttagatgaaga
  • Show more
Description: A cloning plasmid for the TAF9 gene.

TAF9 cloning plasmid

CSB-CL619078HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atggagtctggcaagacggcttctcccaagagcatgccgaaagatgcacagatgatggcacaaatcctgaaggatatggggattacagaatatgagccaagagttataaatcagatgttggagtttgccttccgatatgtgaccacaattctagatgatgcaaaaatttattcaag
  • Show more
Description: A cloning plasmid for the TAF9 gene.

pCMV-SPORT6-TAF9

PVT18246 2 ug
EUR 231

Human TAF9 Antibody (Biotin Conjugate)

32211-05121 150 ug
EUR 369

Rabbit Adenylate kinase isoenzyme 6, TAF9 ELISA KIT

ELI-13360Ra 96 Tests
EUR 928

Human TAF9 AssayLite Antibody (FITC Conjugate)

32211-05141 150 ug
EUR 428

Human TAF9 AssayLite Antibody (RPE Conjugate)

32211-05151 150 ug
EUR 428

Human TAF9 AssayLite Antibody (APC Conjugate)

32211-05161 150 ug
EUR 428

Human TAF9 AssayLite Antibody (PerCP Conjugate)

32211-05171 150 ug
EUR 471

Mouse TAF9 shRNA Plasmid

20-abx979898
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Taf9 ELISA KIT

ELI-17301m 96 Tests
EUR 865

TAF9 ELISA KIT|Human

EF003444 96 Tests
EUR 689

Human TAF9 ELISA KIT

ELI-51992h 96 Tests
EUR 824

Bovine TAF9 ELISA KIT

ELI-53087b 96 Tests
EUR 928

Human TAF9 shRNA Plasmid

20-abx954709
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TAF9 protein (His tag)

80R-1656 100 ug
EUR 305
Description: Purified recombinant Human TAF9 protein

Rat TAF9 shRNA Plasmid

20-abx990703
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TAF9 Recombinant Protein (Human)

RP030871 100 ug Ask for price

TAF9 Recombinant Protein (Human)

RP030874 100 ug Ask for price

TAF9 Recombinant Protein (Rat)

RP232193 100 ug Ask for price

TAF9 Recombinant Protein (Rat)

RP232196 100 ug Ask for price

TAF9 Recombinant Protein (Rat)

RP232199 100 ug Ask for price

TAF9 Recombinant Protein (Mouse)

RP177140 100 ug Ask for price

TAF9 Recombinant Protein (Mouse)

RP177143 100 ug Ask for price

TAF9 Recombinant Protein (Mouse)

RP177146 100 ug Ask for price

TAF9 Recombinant Protein Human

PROTQ16594 Regular: 20ug
EUR 317
Description: TAF9 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 192 amino acids (1-172.a.a) and having a molecular mass of 22.2kDa. ;TAF9 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

TAF9 RNA Polymerase II (Recombinant)

20-abx073191
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Taf9 ORF Vector (Mouse) (pORF)

ORF059048 1.0 ug DNA
EUR 506

Taf9 ORF Vector (Mouse) (pORF)

ORF059049 1.0 ug DNA
EUR 506

Taf9 ORF Vector (Mouse) (pORF)

ORF059050 1.0 ug DNA
EUR 506

TAF9 ORF Vector (Human) (pORF)

ORF010291 1.0 ug DNA
EUR 95

TAF9 ORF Vector (Human) (pORF)

ORF010292 1.0 ug DNA
EUR 95

Taf9 ORF Vector (Rat) (pORF)

ORF077399 1.0 ug DNA
EUR 506

Taf9 ORF Vector (Rat) (pORF)

ORF077400 1.0 ug DNA
EUR 506

Taf9 ORF Vector (Rat) (pORF)

ORF077401 1.0 ug DNA
EUR 506

Recombinant Human TAF9 RNA Polymerase II

7-03625 5µg Ask for price

Recombinant Human TAF9 RNA Polymerase II

7-03626 20µg Ask for price

Recombinant Human TAF9 RNA Polymerase II

7-03627 1mg Ask for price

TAF9 sgRNA CRISPR Lentivector set (Human)

K2329001 3 x 1.0 ug
EUR 339

Taf9 sgRNA CRISPR Lentivector set (Mouse)

K4809801 3 x 1.0 ug
EUR 339

Taf9 sgRNA CRISPR Lentivector set (Rat)

K7139101 3 x 1.0 ug
EUR 339

TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

20-abx115982
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

20-abx001640
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

abx028165-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

abx028165-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

abx238489-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

TAF9 sgRNA CRISPR Lentivector (Human) (Target 1)

K2329002 1.0 ug DNA
EUR 154

TAF9 sgRNA CRISPR Lentivector (Human) (Target 2)

K2329003 1.0 ug DNA
EUR 154

TAF9 sgRNA CRISPR Lentivector (Human) (Target 3)

K2329004 1.0 ug DNA
EUR 154

Taf9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4809802 1.0 ug DNA
EUR 154

TAF9 Rabbit Polyclonal Antibody