TAF9 Rabbit Polyclonal Antibody

TAF9 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    TAF9 Polyclonal Antibody

    ABP60614-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human TAF9 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of TAF9 from Human, Mouse, Rat. This TAF9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TAF9 protein

    TAF9 Rabbit pAb

    A2021-100ul 100 ul
    EUR 308

    TAF9 Rabbit pAb

    A2021-200ul 200 ul
    EUR 459

    TAF9 Rabbit pAb

    A2021-20ul 20 ul
    EUR 183

    TAF9 Rabbit pAb

    A2021-50ul 50 ul
    EUR 223

    TAF9 antibody

    70R-20696 50 ul
    EUR 435
    Description: Rabbit polyclonal TAF9 antibody

    TAF9 antibody

    70R-8040 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal TAF9 antibody

    TAF9 Antibody

    ABD6757 100 ug
    EUR 438

    TAF9 Antibody

    32554-100ul 100ul
    EUR 252

    TAF9 Antibody

    DF6757 200ul
    EUR 304
    Description: TAF9 Antibody detects endogenous levels of total TAF9.

    TAF9 Antibody

    1-CSB-PA619078ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against TAF9. Recognizes TAF9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

    TAF9 Antibody

    1-CSB-PA023100GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against TAF9. Recognizes TAF9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    TAF9 Conjugated Antibody

    C32554 100ul
    EUR 397

    anti- TAF9 antibody

    FNab08489 100µg
    EUR 548.75
    • Immunogen: TAF9 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 32kDa
    • Uniprot ID: Q16594
    • Gene ID: 6880
    • Research Area: Metabolism
    Description: Antibody raised against TAF9

    Human TAF9 Antibody

    32211-05111 150 ug
    EUR 261

    Anti-TAF9 antibody

    PAab08489 100 ug
    EUR 386

    Anti-TAF9 antibody

    STJ25772 100 µl
    EUR 277
    Description: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the smaller subunits of TFIID that binds to the basal transcription factor GTF2B as well as to several transcriptional activators such as p53 and VP16. In human, TAF9 and AK6 (GeneID: 102157402) are two distinct genes that share 5' exons. A similar but distinct gene (TAF9L) has been found on the X chromosome and a pseudogene has been identified on chromosome 19. Alternative splicing results in multiple transcript variants.

    Anti-TAF9 antibody

    STJ193048 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to TAF9

    Taf9/ Rat Taf9 ELISA Kit

    ELI-53088r 96 Tests
    EUR 886

    Taf9/ Rat Taf9 ELISA Kit

    ELI-42939r 96 Tests
    EUR 886

    TAF9 siRNA

    20-abx905447
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TAF9 siRNA

    20-abx935993
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TAF9 siRNA

    20-abx935994
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    pENTR223-TAF9

    PVT12668 2 ug
    EUR 391

    TAF9 Blocking Peptide

    33R-3402 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TAF9 antibody, catalog no. 70R-8040

    TAF9 Blocking Peptide

    DF6757-BP 1mg
    EUR 195

    TAF9 cloning plasmid

    CSB-CL619078HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 519
    • Sequence: atgttgcttccgaacatcctgctcaccggtacaccaggggttggaaaaaccacactaggcaaagaacttgcgtcaaaatcaggactgaaatacattaatgtgggtgatttagctcgagaagagcaattgtatgatggctatgatgaagagtatgactgtcccattttagatgaaga
    • Show more
    Description: A cloning plasmid for the TAF9 gene.

    TAF9 cloning plasmid

    CSB-CL619078HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 795
    • Sequence: atggagtctggcaagacggcttctcccaagagcatgccgaaagatgcacagatgatggcacaaatcctgaaggatatggggattacagaatatgagccaagagttataaatcagatgttggagtttgccttccgatatgtgaccacaattctagatgatgcaaaaatttattcaag
    • Show more
    Description: A cloning plasmid for the TAF9 gene.

    pCMV-SPORT6-TAF9

    PVT18246 2 ug
    EUR 231

    Human TAF9 Antibody (Biotin Conjugate)

    32211-05121 150 ug
    EUR 369

    Rabbit Adenylate kinase isoenzyme 6, TAF9 ELISA KIT

    ELI-13360Ra 96 Tests
    EUR 928

    Human TAF9 AssayLite Antibody (FITC Conjugate)

    32211-05141 150 ug
    EUR 428

    Human TAF9 AssayLite Antibody (RPE Conjugate)

    32211-05151 150 ug
    EUR 428

    Human TAF9 AssayLite Antibody (APC Conjugate)

    32211-05161 150 ug
    EUR 428

    Human TAF9 AssayLite Antibody (PerCP Conjugate)

    32211-05171 150 ug
    EUR 471

    Mouse TAF9 shRNA Plasmid

    20-abx979898
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse Taf9 ELISA KIT

    ELI-17301m 96 Tests
    EUR 865

    TAF9 ELISA KIT|Human

    EF003444 96 Tests
    EUR 689

    Human TAF9 ELISA KIT

    ELI-51992h 96 Tests
    EUR 824

    Bovine TAF9 ELISA KIT

    ELI-53087b 96 Tests
    EUR 928

    Human TAF9 shRNA Plasmid

    20-abx954709
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    TAF9 protein (His tag)

    80R-1656 100 ug
    EUR 305
    Description: Purified recombinant Human TAF9 protein

    Rat TAF9 shRNA Plasmid

    20-abx990703
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    TAF9 Recombinant Protein (Human)

    RP030871 100 ug Ask for price

    TAF9 Recombinant Protein (Human)

    RP030874 100 ug Ask for price

    TAF9 Recombinant Protein (Rat)

    RP232193 100 ug Ask for price

    TAF9 Recombinant Protein (Rat)

    RP232196 100 ug Ask for price

    TAF9 Recombinant Protein (Rat)

    RP232199 100 ug Ask for price

    TAF9 Recombinant Protein (Mouse)

    RP177140 100 ug Ask for price

    TAF9 Recombinant Protein (Mouse)

    RP177143 100 ug Ask for price

    TAF9 Recombinant Protein (Mouse)

    RP177146 100 ug Ask for price

    TAF9 Recombinant Protein Human

    PROTQ16594 Regular: 20ug
    EUR 317
    Description: TAF9 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 192 amino acids (1-172.a.a) and having a molecular mass of 22.2kDa. ;TAF9 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

    TAF9 RNA Polymerase II (Recombinant)

    20-abx073191
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.

    Taf9 ORF Vector (Mouse) (pORF)

    ORF059048 1.0 ug DNA
    EUR 506

    Taf9 ORF Vector (Mouse) (pORF)

    ORF059049 1.0 ug DNA
    EUR 506

    Taf9 ORF Vector (Mouse) (pORF)

    ORF059050 1.0 ug DNA
    EUR 506

    TAF9 ORF Vector (Human) (pORF)

    ORF010291 1.0 ug DNA
    EUR 95

    TAF9 ORF Vector (Human) (pORF)

    ORF010292 1.0 ug DNA
    EUR 95

    Taf9 ORF Vector (Rat) (pORF)

    ORF077399 1.0 ug DNA
    EUR 506

    Taf9 ORF Vector (Rat) (pORF)

    ORF077400 1.0 ug DNA
    EUR 506

    Taf9 ORF Vector (Rat) (pORF)

    ORF077401 1.0 ug DNA
    EUR 506

    Recombinant Human TAF9 RNA Polymerase II

    7-03625 5µg Ask for price

    Recombinant Human TAF9 RNA Polymerase II

    7-03626 20µg Ask for price

    Recombinant Human TAF9 RNA Polymerase II

    7-03627 1mg Ask for price

    TAF9 sgRNA CRISPR Lentivector set (Human)

    K2329001 3 x 1.0 ug
    EUR 339

    Taf9 sgRNA CRISPR Lentivector set (Mouse)

    K4809801 3 x 1.0 ug
    EUR 339

    Taf9 sgRNA CRISPR Lentivector set (Rat)

    K7139101 3 x 1.0 ug
    EUR 339

    TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

    20-abx115982
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

    20-abx001640
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

    abx028165-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

    abx028165-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

    abx238489-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    TAF9 sgRNA CRISPR Lentivector (Human) (Target 1)

    K2329002 1.0 ug DNA
    EUR 154

    TAF9 sgRNA CRISPR Lentivector (Human) (Target 2)

    K2329003 1.0 ug DNA
    EUR 154

    TAF9 sgRNA CRISPR Lentivector (Human) (Target 3)

    K2329004 1.0 ug DNA
    EUR 154

    Taf9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4809802 1.0 ug DNA
    EUR 154

    TAF9 Rabbit Polyclonal Antibody