RBP1 Rabbit Polyclonal Antibody

RBP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

RBP1 Polyclonal Antibody
27262-100ul 100ul
EUR 252
RBP1 Polyclonal Antibody
27262-50ul 50ul
EUR 187
RBP1 Rabbit pAb
A10029-100ul 100 ul
EUR 308
RBP1 Rabbit pAb
A10029-200ul 200 ul
EUR 459
RBP1 Rabbit pAb
A10029-20ul 20 ul
EUR 183
RBP1 Rabbit pAb
A10029-50ul 50 ul
EUR 223
RBP1 Polyclonal Conjugated Antibody
C27262 100ul
EUR 397
Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
DLR-RBP1-Hu-48T 48T
EUR 479
  • Should the Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinol Binding Protein 1, Cellular (RBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
DLR-RBP1-Hu-96T 96T
EUR 621
  • Should the Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinol Binding Protein 1, Cellular (RBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RD-RBP1-Hu-48Tests 48 Tests
EUR 478
Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RD-RBP1-Hu-96Tests 96 Tests
EUR 662
Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RDR-RBP1-Hu-48Tests 48 Tests
EUR 500
Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RDR-RBP1-Hu-96Tests 96 Tests
EUR 692
Polyclonal Goat Anti-RBP1 Antibody
APG00276G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RBP1 . This antibody is tested and proven to work in the following applications:
RBP1 antibody
10R-5603 100 ul
EUR 726
Description: Mouse monoclonal RBP1 antibody
RBP1 antibody
10R-5604 100 ul
EUR 691
Description: Mouse monoclonal RBP1 antibody
RBP1 antibody
70R-12616 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RBP1 antibody
RBP1 antibody
70R-12617 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RBP1 antibody
RBP1 antibody
70R-1274 100 ug
EUR 377
Description: Rabbit polyclonal RBP1 antibody raised against the middle region of RBP1
RBP1 Antibody
1-CSB-PA019480GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen affinity purification
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
RBP1 Antibody
1-CSB-PA019480YA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Polyclonal RBP1 / CRBP Antibody (C-Terminus)
APG01059G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RBP1 / CRBP (C-Terminus). This antibody is tested and proven to work in the following applications:
anti- RBP1 antibody
FNab07188 100µg
EUR 585
  • Immunogen: retinol binding protein 1, cellular
  • Uniprot ID: P09455
  • Gene ID: 5947
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against RBP1
Anti-RBP1 antibody
PAab07188 100 ug
EUR 412
Anti-RBP1 antibody
STJ70670 100 µg
EUR 359
Anti-RBP1 antibody
STJ112069 100 µl
EUR 277
Description: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-RBP1 antibody
STJ193046 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RBP1
Rbp1/ Rat Rbp1 ELISA Kit
ELI-04007r 96 Tests
EUR 886
RBP1 siRNA
20-abx904510
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RBP1 siRNA
20-abx931119
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RBP1 siRNA
20-abx931120
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RBP1 Antibody, HRP conjugated
1-CSB-PA019480YB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RBP1 Antibody, FITC conjugated
1-CSB-PA019480YC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RBP1 Antibody, Biotin conjugated
1-CSB-PA019480YD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
RBP1 cloning plasmid
CSB-CL019480HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 408
  • Sequence: ATGCCAGTCGACTTCACTGGGTACTGGAAGATGTTGGTCAACGAGAATTTCGAGGAGTACCTGCGCGCCCTCGACGTCAATGTGGCCTTGCGCAAAATCGCCAACTTGCTGAAGCCAGACAAAGAGATCGTGCAGGACGGTGACCATATGATCATCCGCACGCTGAGCACTTTTAG
  • Show more
Description: A cloning plasmid for the RBP1 gene.
RBP1 Blocking Peptide
33R-4007 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBP1 antibody, catalog no. 70R-1274
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine)
4-PAA400Bo01
  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1)
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse)
4-PAA400Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1)
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig)
4-PAA400Po01
  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1)
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat)
4-PAA400Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1)
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), APC
4-PAA400Bo01-APC
  • EUR 363.00
  • EUR 3527.00
  • EUR 975.00
  • EUR 465.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), Biotinylated
4-PAA400Bo01-Biotin
  • EUR 324.00
  • EUR 2644.00
  • EUR 773.00
  • EUR 399.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), Cy3
4-PAA400Bo01-Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), FITC
4-PAA400Bo01-FITC
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), HRP
4-PAA400Bo01-HRP
  • EUR 331.00
  • EUR 3073.00
  • EUR 862.00
  • EUR 419.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), PE
4-PAA400Bo01-PE
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), APC
4-PAA400Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), Biotinylated
4-PAA400Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), Cy3
4-PAA400Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), FITC
4-PAA400Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), HRP
4-PAA400Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), PE
4-PAA400Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), APC
4-PAA400Po01-APC
  • EUR 363.00
  • EUR 3527.00
  • EUR 975.00
  • EUR 465.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), Biotinylated
4-PAA400Po01-Biotin
  • EUR 324.00
  • EUR 2644.00
  • EUR 773.00
  • EUR 399.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), Cy3
4-PAA400Po01-Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), FITC
4-PAA400Po01-FITC
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), HRP
4-PAA400Po01-HRP
  • EUR 331.00
  • EUR 3073.00
  • EUR 862.00
  • EUR 419.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), PE
4-PAA400Po01-PE
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), APC
4-PAA400Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), Biotinylated
4-PAA400Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), Cy3
4-PAA400Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), FITC
4-PAA400Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), HRP
4-PAA400Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), PE
4-PAA400Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.
Retinol-Binding Protein 1 (Rbp1) Antibody
20-abx116773
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Retinol-Binding Protein 1 (RBP1) Antibody
20-abx135947
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Retinol-Binding Protein 1 (RBP1) Antibody
abx433219-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Retinol-Binding Protein 1 (RBP1) Antibody
abx237188-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Rat RBP1 shRNA Plasmid
20-abx984766
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RBP1 ELISA Kit
ELA-E1209h 96 Tests
EUR 824
RBP1 ELISA KIT|Human
EF004456 96 Tests
EUR 689
Human RBP1 shRNA Plasmid
20-abx954026
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RBP1 Rabbit Polyclonal Antibody