GPER Rabbit Polyclonal Antibody

GPER Rabbit Polyclonal Antibody

Contact Us Below To Order :

    Polyclonal GPER Antibody (C-term)

    APR07130G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER (C-term). This antibody is tested and proven to work in the following applications:

    Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

    DLR-GPER-Hu-48T 48T
    EUR 517
    • Should the Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

    DLR-GPER-Hu-96T 96T
    EUR 673
    • Should the Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

    DLR-GPER-Mu-48T 48T
    EUR 527
    • Should the Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

    DLR-GPER-Mu-96T 96T
    EUR 688
    • Should the Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

    RD-GPER-Hu-48Tests 48 Tests
    EUR 521

    Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

    RD-GPER-Hu-96Tests 96 Tests
    EUR 723

    Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

    RD-GPER-Mu-48Tests 48 Tests
    EUR 533

    Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

    RD-GPER-Mu-96Tests 96 Tests
    EUR 740

    Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

    RDR-GPER-Hu-48Tests 48 Tests
    EUR 544

    Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

    RDR-GPER-Hu-96Tests 96 Tests
    EUR 756

    Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

    RDR-GPER-Mu-48Tests 48 Tests
    EUR 557

    Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

    RDR-GPER-Mu-96Tests 96 Tests
    EUR 774

    Gper/ Rat Gper ELISA Kit

    ELI-03937r 96 Tests
    EUR 886

    Polyclonal GPER antibody - C-terminal region

    AMRa00042G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER - C-terminal region. This antibody is tested and proven to work in the following applications:

    Anti-GPER antibody

    STJ192629 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to GPER

    GPER cloning plasmid

    CSB-CL859933HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1128
    • Sequence: atggatgtgacttcccaagcccggggcgtgggcctggagatgtacctaggcaccgcgcagcctgcggcccccaacaccacctcccccgagctcaacctgtcccacccgctcctgggcaccgccctggccaatgggacaggtgagctctcggagcaccagcagtacgtgatcggcc
    • Show more
    Description: A cloning plasmid for the GPER gene.

    GPER ELISA KIT|Human

    EF004242 96 Tests
    EUR 689

    GPER Recombinant Protein (Human)

    RP013738 100 ug Ask for price

    GPER Recombinant Protein (Rat)

    RP203225 100 ug Ask for price

    GPER ORF Vector (Human) (pORF)

    ORF004580 1.0 ug DNA
    EUR 95

    Gper ORF Vector (Rat) (pORF)

    ORF067743 1.0 ug DNA
    EUR 506

    GPER ELISA Kit (Human) (OKCD08888)

    OKCD08888 96 Wells
    EUR 975
    Description: Description of target: This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein that localizes to the endoplasmic reticulum. The protein binds estrogen, resulting in intracellular calcium mobilization and synthesis of phosphatidylinositol 3,4,5-trisphosphate in the nucleus. This protein therefore plays a role in the rapid nongenomic signaling events widely observed following stimulation of cells and tissues with estrogen. Alternate transcriptional splice variants which encode the same protein have been characterized.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.125ng/mL

    G Protein Coupled Estrogen Receptor 1 (GPER) Antibody

    20-abx172491
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    G Protein Coupled Estrogen Receptor 1 (GPER) Antibody

    20-abx176524
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    G Protein Coupled Estrogen Receptor 1 (GPER) Antibody

    20-abx176525
    • EUR 1233.00
    • EUR 592.00
    • 1 mg
    • 200 ug
    • Please enquire.

    G Protein Coupled Estrogen Receptor 1 (GPER) Antibody

    20-abx176526
    • EUR 1233.00
    • EUR 592.00
    • 1 mg
    • 200 ug
    • Please enquire.

    GPER sgRNA CRISPR Lentivector set (Human)

    K0887401 3 x 1.0 ug
    EUR 339

    Gper sgRNA CRISPR Lentivector set (Rat)

    K7043101 3 x 1.0 ug
    EUR 339

    GPER sgRNA CRISPR Lentivector (Human) (Target 1)

    K0887402 1.0 ug DNA
    EUR 154

    GPER sgRNA CRISPR Lentivector (Human) (Target 2)

    K0887403 1.0 ug DNA
    EUR 154

    GPER sgRNA CRISPR Lentivector (Human) (Target 3)

    K0887404 1.0 ug DNA
    EUR 154

    Gper sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7043102 1.0 ug DNA
    EUR 154

    Gper sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7043103 1.0 ug DNA
    EUR 154

    GPER Rabbit Polyclonal Antibody