GPER Rabbit Polyclonal Antibody

GPER Rabbit Polyclonal Antibody

Contact Us Below To Order :

Polyclonal GPER Antibody (C-term)

APR07130G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER (C-term). This antibody is tested and proven to work in the following applications:

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

DLR-GPER-Hu-48T 48T
EUR 517
  • Should the Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

DLR-GPER-Hu-96T 96T
EUR 673
  • Should the Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

DLR-GPER-Mu-48T 48T
EUR 527
  • Should the Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

DLR-GPER-Mu-96T 96T
EUR 688
  • Should the Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RD-GPER-Hu-48Tests 48 Tests
EUR 521

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RD-GPER-Hu-96Tests 96 Tests
EUR 723

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RD-GPER-Mu-48Tests 48 Tests
EUR 533

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RD-GPER-Mu-96Tests 96 Tests
EUR 740

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RDR-GPER-Hu-48Tests 48 Tests
EUR 544

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RDR-GPER-Hu-96Tests 96 Tests
EUR 756

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RDR-GPER-Mu-48Tests 48 Tests
EUR 557

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit

RDR-GPER-Mu-96Tests 96 Tests
EUR 774

Gper/ Rat Gper ELISA Kit

ELI-03937r 96 Tests
EUR 886

Polyclonal GPER antibody - C-terminal region

AMRa00042G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER - C-terminal region. This antibody is tested and proven to work in the following applications:

Anti-GPER antibody

STJ192629 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPER

GPER cloning plasmid

CSB-CL859933HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1128
  • Sequence: atggatgtgacttcccaagcccggggcgtgggcctggagatgtacctaggcaccgcgcagcctgcggcccccaacaccacctcccccgagctcaacctgtcccacccgctcctgggcaccgccctggccaatgggacaggtgagctctcggagcaccagcagtacgtgatcggcc
  • Show more
Description: A cloning plasmid for the GPER gene.

GPER ELISA KIT|Human

EF004242 96 Tests
EUR 689

GPER Recombinant Protein (Human)

RP013738 100 ug Ask for price

GPER Recombinant Protein (Rat)

RP203225 100 ug Ask for price

GPER ORF Vector (Human) (pORF)

ORF004580 1.0 ug DNA
EUR 95

Gper ORF Vector (Rat) (pORF)

ORF067743 1.0 ug DNA
EUR 506

G Protein Coupled Estrogen Receptor 1 (GPER) Antibody

20-abx172491
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

G Protein Coupled Estrogen Receptor 1 (GPER) Antibody

20-abx176524
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

G Protein Coupled Estrogen Receptor 1 (GPER) Antibody

20-abx176525
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

G Protein Coupled Estrogen Receptor 1 (GPER) Antibody

20-abx176526
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

GPER sgRNA CRISPR Lentivector set (Human)

K0887401 3 x 1.0 ug
EUR 339

Gper sgRNA CRISPR Lentivector set (Rat)

K7043101 3 x 1.0 ug
EUR 339

GPER sgRNA CRISPR Lentivector (Human) (Target 1)

K0887402 1.0 ug DNA
EUR 154

GPER sgRNA CRISPR Lentivector (Human) (Target 2)

K0887403 1.0 ug DNA
EUR 154

GPER sgRNA CRISPR Lentivector (Human) (Target 3)

K0887404 1.0 ug DNA
EUR 154

Gper sgRNA CRISPR Lentivector (Rat) (Target 1)

K7043102 1.0 ug DNA
EUR 154

Gper sgRNA CRISPR Lentivector (Rat) (Target 2)

K7043103 1.0 ug DNA
EUR 154

Gper sgRNA CRISPR Lentivector (Rat) (Target 3)

K7043104 1.0 ug DNA
EUR 154

GPER Rabbit Polyclonal Antibody