ETS2 Rabbit Polyclonal Antibody

ETS2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    ETS2 Polyclonal Antibody

    ES11876-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ETS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    ETS2 Rabbit pAb

    A14486-100ul 100 ul
    EUR 308

    ETS2 Rabbit pAb

    A14486-200ul 200 ul
    EUR 459

    ETS2 Rabbit pAb

    A14486-20ul 20 ul
    EUR 183

    ETS2 Rabbit pAb

    A14486-50ul 50 ul
    EUR 223

    ETS2 Rabbit pAb

    A7329-100ul 100 ul
    EUR 308

    ETS2 Rabbit pAb

    A7329-200ul 200 ul
    EUR 459

    ETS2 Rabbit pAb

    A7329-20ul 20 ul
    EUR 183

    ETS2 Rabbit pAb

    A7329-50ul 50 ul
    EUR 223

    ETS2 Rabbit pAb

    A16844-100ul 100 ul
    EUR 308

    ETS2 Rabbit pAb

    A16844-200ul 200 ul
    EUR 459

    ETS2 Rabbit pAb

    A16844-20ul 20 ul
    EUR 183

    ETS2 Rabbit pAb

    A16844-50ul 50 ul
    EUR 223

    ETS2 Rabbit pAb

    A16845-100ul 100 ul
    EUR 308

    ETS2 Rabbit pAb

    A16845-200ul 200 ul
    EUR 459

    ETS2 Rabbit pAb

    A16845-20ul 20 ul
    EUR 183

    ETS2 Rabbit pAb

    A16845-50ul 50 ul
    EUR 223

    Polyclonal ETS2 Antibody (Center)

    APR06204G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ETS2 (Center). This antibody is tested and proven to work in the following applications:

    ETS2 antibody

    70R-17160 50 ul
    EUR 435
    Description: Rabbit polyclonal ETS2 antibody

    ETS2 Antibody

    36451-100ul 100ul
    EUR 252

    ETS2 antibody

    10R-1761 100 ug
    EUR 512
    Description: Mouse monoclonal ETS2 antibody

    ETS2 Antibody

    1-CSB-PA908387
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

    ETS2 Antibody

    1-CSB-PA695360
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

    ETS2 Antibody

    1-CSB-PA007853GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    ETS2 Antibody

    1-CSB-PA007853LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

    ETS2 Conjugated Antibody

    C36451 100ul
    EUR 397

    anti- ETS2 antibody

    FNab02879 100µg
    EUR 548.75
    • Immunogen: v-ets erythroblastosis virus E26 oncogene homolog 2(avian)
    • Uniprot ID: P15036
    • Gene ID: 2114
    • Research Area: Signal Transduction, Metabolism, Cardiovascular, Cancer, Developmental biology
    Description: Antibody raised against ETS2

    Anti-ETS2 antibody

    PAab02879 100 ug
    EUR 386

    Anti-ETS2 antibody

    STJ116696 100 µl
    EUR 277
    Description: This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants.

    Anti-ETS2 antibody

    STJ119215 100 µl
    EUR 277

    Anti-ETS2 antibody

    STJ119216 100 µl
    EUR 277

    Anti-ETS2 antibody

    STJ29468 100 µl
    EUR 277
    Description: This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants.

    Anti-ETS2 antibody

    STJ193034 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to ETS2

    ETS2 siRNA

    20-abx915738
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ETS2 siRNA

    20-abx915739
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    anti-ETS2

    YF-PA11633 50 ul
    EUR 363
    Description: Mouse polyclonal to ETS2

    anti-ETS2

    YF-PA11634 50 ug
    EUR 363
    Description: Mouse polyclonal to ETS2

    anti-ETS2

    YF-PA23672 50 ul
    EUR 334
    Description: Mouse polyclonal to ETS2

    ETS2 Antibody, HRP conjugated

    1-CSB-PA007853LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    ETS2 Antibody, FITC conjugated

    1-CSB-PA007853LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    ETS2 Antibody, Biotin conjugated

    1-CSB-PA007853LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    ETS2 cloning plasmid

    CSB-CL007853HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1410
    • Sequence: atgaatgatttcggaatcaagaatatggaccaggtagcccctgtggctaacagttacagagggacactcaagcgccagccagcctttgacacctttgatgggtccctgtttgctgtttttccttctctaaatgaagagcaaacactgcaagaagtgccaacaggcttggattcca
    • Show more
    Description: A cloning plasmid for the ETS2 gene.

    ETS2 cloning plasmid

    CSB-CL007853HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1410
    • Sequence: atgaatgatttcggaatcaagaatatggaccaggtagcccctgtggctaacagttacagagggacactcaagcgccagccagcctttgacacctttgatgggtccctgtttgctgtttttccttctctaaatgaagagcaaacactgcaagaagtgccaacaggcttggattcca
    • Show more
    Description: A cloning plasmid for the ETS2 gene.

    pCMV-SPORT6-ETS2

    PVT13519 2 ug
    EUR 391

    ETS2 Repressor Factor (ERF) Antibody

    20-abx013510
    • EUR 314.00
    • EUR 98.00
    • EUR 398.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 200 ug
    • 300 µg
    • Shipped within 5-10 working days.

    ETS2 Repressor Factor (ERF) Antibody

    abx031308-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    ETS2 Repressor Factor (ERF) Antibody

    abx031308-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    ETS2 Repressor Factor (ERF) Antibody

    abx331359-100ul 100 ul
    EUR 425
    • Shipped within 5-10 working days.

    ETS2 Rabbit Polyclonal Antibody