ETS2 Rabbit Polyclonal Antibody

ETS2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

ETS2 Polyclonal Antibody

ABP58508-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ETS2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ETS2 from Human, Mouse. This ETS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ETS2 protein

ETS2 Rabbit pAb

A16844-100ul 100 ul
EUR 308

ETS2 Rabbit pAb

A16844-200ul 200 ul
EUR 459

ETS2 Rabbit pAb

A16844-20ul 20 ul
EUR 183

ETS2 Rabbit pAb

A16844-50ul 50 ul
EUR 223

ETS2 Rabbit pAb

A16845-100ul 100 ul
EUR 308

ETS2 Rabbit pAb

A16845-200ul 200 ul
EUR 459

ETS2 Rabbit pAb

A16845-20ul 20 ul
EUR 183

ETS2 Rabbit pAb

A16845-50ul 50 ul
EUR 223

ETS2 Rabbit pAb

A14486-100ul 100 ul
EUR 308

ETS2 Rabbit pAb

A14486-200ul 200 ul
EUR 459

ETS2 Rabbit pAb

A14486-20ul 20 ul
EUR 183

ETS2 Rabbit pAb

A14486-50ul 50 ul
EUR 223

ETS2 Rabbit pAb

A7329-100ul 100 ul
EUR 308

ETS2 Rabbit pAb

A7329-200ul 200 ul
EUR 459

ETS2 Rabbit pAb

A7329-20ul 20 ul
EUR 183

ETS2 Rabbit pAb

A7329-50ul 50 ul
EUR 223

Polyclonal ETS2 Antibody (Center)

APR06204G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ETS2 (Center). This antibody is tested and proven to work in the following applications:

ETS2 Antibody

36451-100ul 100ul
EUR 252

ETS2 antibody

10R-1761 100 ug
EUR 512
Description: Mouse monoclonal ETS2 antibody

ETS2 antibody

70R-17160 50 ul
EUR 435
Description: Rabbit polyclonal ETS2 antibody

ETS2 Antibody

1-CSB-PA908387
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

ETS2 Antibody

1-CSB-PA007853GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ETS2 Antibody

1-CSB-PA007853LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

ETS2 Antibody

1-CSB-PA695360
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

ETS2 Conjugated Antibody

C36451 100ul
EUR 397

anti- ETS2 antibody

FNab02879 100µg
EUR 548.75
  • Immunogen: v-ets erythroblastosis virus E26 oncogene homolog 2(avian)
  • Uniprot ID: P15036
  • Gene ID: 2114
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Cancer, Developmental biology
Description: Antibody raised against ETS2

Anti-ETS2 antibody

PAab02879 100 ug
EUR 386

Anti-ETS2 antibody

STJ29468 100 µl
EUR 277
Description: This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants.

Anti-ETS2 antibody

STJ119215 100 µl
EUR 277

Anti-ETS2 antibody

STJ119216 100 µl
EUR 277

Anti-ETS2 antibody

STJ116696 100 µl
EUR 277
Description: This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants.

Anti-ETS2 antibody

STJ193034 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ETS2

ETS2 siRNA

20-abx915738
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ETS2 siRNA

20-abx915739
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ETS2

YF-PA11633 50 ul
EUR 363
Description: Mouse polyclonal to ETS2

anti-ETS2

YF-PA11634 50 ug
EUR 363
Description: Mouse polyclonal to ETS2

anti-ETS2

YF-PA23672 50 ul
EUR 334
Description: Mouse polyclonal to ETS2

ETS2 Antibody, HRP conjugated

1-CSB-PA007853LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ETS2 Antibody, FITC conjugated

1-CSB-PA007853LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ETS2 Antibody, Biotin conjugated

1-CSB-PA007853LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ETS2 cloning plasmid

CSB-CL007853HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1410
  • Sequence: atgaatgatttcggaatcaagaatatggaccaggtagcccctgtggctaacagttacagagggacactcaagcgccagccagcctttgacacctttgatgggtccctgtttgctgtttttccttctctaaatgaagagcaaacactgcaagaagtgccaacaggcttggattcca
  • Show more
Description: A cloning plasmid for the ETS2 gene.

ETS2 cloning plasmid

CSB-CL007853HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1410
  • Sequence: atgaatgatttcggaatcaagaatatggaccaggtagcccctgtggctaacagttacagagggacactcaagcgccagccagcctttgacacctttgatgggtccctgtttgctgtttttccttctctaaatgaagagcaaacactgcaagaagtgccaacaggcttggattcca
  • Show more
Description: A cloning plasmid for the ETS2 gene.

pCMV-SPORT6-ETS2

PVT13519 2 ug
EUR 391

ETS2 Repressor Factor (ERF) Antibody

20-abx013510
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

ETS2 Repressor Factor (ERF) Antibody

abx031308-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ETS2 Repressor Factor (ERF) Antibody

abx031308-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ETS2 Repressor Factor (ERF) Antibody

20-abx325231
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ETS2 Rabbit Polyclonal Antibody