PRKRA Rabbit Polyclonal Antibody

PRKRA Rabbit Polyclonal Antibody

Contact Us Below To Order :

PRKRA Polyclonal Antibody
ABP60000-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PRKRA protein
  • Applications tips:
Description: A polyclonal antibody for detection of PRKRA from Human, Mouse, Rat. This PRKRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRKRA protein
PRKRA Polyclonal Antibody
ABP60000-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PRKRA protein
  • Applications tips:
Description: A polyclonal antibody for detection of PRKRA from Human, Mouse, Rat. This PRKRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRKRA protein
PRKRA Polyclonal Antibody
ES11874-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRKRA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PRKRA Polyclonal Antibody
ES11874-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRKRA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PRKRA Rabbit pAb
A5417-100ul 100 ul
EUR 308
PRKRA Rabbit pAb
A5417-200ul 200 ul
EUR 459
PRKRA Rabbit pAb
A5417-20ul 20 ul
EUR 183
PRKRA Rabbit pAb
A5417-50ul 50 ul
EUR 223
PRKRA antibody
70R-19532 50 ul
EUR 435
Description: Rabbit polyclonal PRKRA antibody
PRKRA Antibody
32843-100ul 100ul
EUR 252
PRKRA antibody
10R-1568 100 ug
EUR 512
Description: Mouse monoclonal PRKRA antibody
PRKRA Antibody
1-CSB-PA13669A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500
PRKRA Antibody
DF7334 200ul
EUR 304
Description: PRKRA Antibody detects endogenous levels of total PRKRA.
PRKRA antibody
70R-5896 50 ug
EUR 467
Description: Rabbit polyclonal PRKRA antibody raised against the middle region of PRKRA
PRKRA antibody
70R-5897 50 ug
EUR 467
Description: Rabbit polyclonal PRKRA antibody raised against the N terminal of PRKRA
PRKRA Antibody
1-CSB-PA018717GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
PRKRA Antibody
ABD7334 100 ug
EUR 438
PRKRA Polyclonal Antibody, Biotin Conjugated
A68271 100 µg
EUR 570.55
Description: reagents widely cited
PRKRA Polyclonal Antibody, FITC Conjugated
A68272 100 µg
EUR 570.55
Description: Ask the seller for details
PRKRA Polyclonal Antibody, HRP Conjugated
A68273 100 µg
EUR 570.55
Description: The best epigenetics products
Prkra/ Rat Prkra ELISA Kit
ELI-21653r 96 Tests
EUR 886
PRKRA (pS246) Antibody
abx032043-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
PRKRA (pS246) Antibody
abx032043-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
PRKRA Conjugated Antibody
C32843 100ul
EUR 397
PRKRA Antibody (HRP)
20-abx306568
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PRKRA Antibody (FITC)
20-abx306569
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PRKRA Antibody (Biotin)
20-abx306570
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-PRKRA antibody
STJ27370 100 µl
EUR 277
Description: This gene encodes a protein kinase activated by double-stranded RNA which mediates the effects of interferon in response to viral infection. Mutations in this gene have been associated with dystonia. Alternative splicing results in multiple transcript variants.
Anti-PRKRA antibody
STJ193032 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PRKRA
PRKRA siRNA
20-abx904247
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PRKRA siRNA
20-abx929793
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PRKRA siRNA
20-abx929794
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PRKRA Antibody, HRP conjugated
1-CSB-PA13669B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PRKRA Antibody, FITC conjugated
1-CSB-PA13669C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PRKRA Antibody, Biotin conjugated
1-CSB-PA13669D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PRKRA Blocking Peptide
33R-8043 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRKRA antibody, catalog no. 70R-5896
PRKRA Blocking Peptide
33R-6483 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRKRA antibody, catalog no. 70R-5897
PRKRA Blocking Peptide
DF7334-BP 1mg
EUR 195
PRKRA cloning plasmid
CSB-CL018717HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 942
  • Sequence: atgtcccagagcaggcaccgcgccgaggccccgccgctggagcgcgaggacagtgggaccttcagtttggggaagatgataacagctaagccagggaaaacaccgattcaggtattacacgaatacggcatgaagaccaagaacatcccagtttatgaatgtgaaagatctgatgt
  • Show more
Description: A cloning plasmid for the PRKRA gene.
PRKRA protein (His tag)
80R-3908 50 ug
EUR 435
Description: Purified recombinant PRKRA protein (His tag)
Bovine PRKRA ELISA KIT
ELI-15441b 96 Tests
EUR 928
Mouse Prkra ELISA KIT
ELI-43081m 96 Tests
EUR 865
Human PRKRA ELISA KIT
ELI-45408h 96 Tests
EUR 824
Rat PRKRA shRNA Plasmid
20-abx989655
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PRKRA Rabbit Polyclonal Antibody