IGKC Rabbit Polyclonal Antibody

IGKC Rabbit Polyclonal Antibody

Contact Us Below To Order :

IGKC Polyclonal Antibody

ABP58905-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human IGKC protein
  • Applications tips:
Description: A polyclonal antibody for detection of IGKC from Human. This IGKC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGKC protein

IGKC Polyclonal Antibody

ABP58905-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human IGKC protein
  • Applications tips:
Description: A polyclonal antibody for detection of IGKC from Human. This IGKC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGKC protein

IGKC Polyclonal Antibody

ABP58905-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IGKC protein
  • Applications tips:
Description: A polyclonal antibody for detection of IGKC from Human. This IGKC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGKC protein

IGKC Antibody

1-CSB-PA011340LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

Anti-IGKC antibody

STJ193004 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IGKC

IGKC Antibody, HRP conjugated

1-CSB-PA011340LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IGKC Antibody, FITC conjugated

1-CSB-PA011340LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IGKC Antibody, Biotin conjugated

1-CSB-PA011340LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

IGKC cloning plasmid

CSB-CL011340HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 705
  • Sequence: atgagggtccccgctcagctcctggggctcctgctgctctggctcccaggtgccagatgtgccatccggatgacccagtctccatcctcattctctgcatctacaggagacagagtcaccatcacttgtcgggcgagtcagagtattggtagttatttagcctggtatcagcaaaa
  • Show more
Description: A cloning plasmid for the IGKC gene.

IGKC cloning plasmid

CSB-CL011340HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atggacatgagggtcccctctcagctcctggggctcctgctgctctggctcccaggtgccagatgtgacatccagttgacccagtctccatccttcctgtctgcatctgtaggagacagagtcaccatcacttgccgggccagtcagggcattagcagttatttagcctggtatca
  • Show more
Description: A cloning plasmid for the IGKC gene.

IGKC cloning plasmid

CSB-CL011340HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 714
  • Sequence: atggacatgagggtccccgctcagctcctggggctcctgctgctctggttcccaggttccagatgcgacatccacatgacccagtctccatcttctgtgtctgcatctgtaggagacagagtcaccatcacctgtcgggcgagtcagcgtattagcagcagctggttagcctggta
  • Show more
Description: A cloning plasmid for the IGKC gene.

IGKC cloning plasmid

CSB-CL011340HU4-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 723
  • Sequence: ATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCAGGATCCAGTGGGGATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTATACAGTGATGGAAACACCTACTTGAA
  • Show more
Description: A cloning plasmid for the IGKC gene.

IGKC Recombinant Protein (Human)

RP015805 100 ug Ask for price

IGKC Recombinant Protein (Human)

RP015808 100 ug Ask for price

IGKC Recombinant Protein (Human)

RP015811 100 ug Ask for price

IGKC Recombinant Protein (Human)

RP040006 100 ug Ask for price

IGKC ORF Vector (Human) (pORF)

ORF005269 1.0 ug DNA
EUR 95

IGKC ORF Vector (Human) (pORF)

ORF005270 1.0 ug DNA
EUR 95

IGKC ORF Vector (Human) (pORF)

ORF005271 1.0 ug DNA
EUR 95

IGKC ORF Vector (Human) (pORF)

ORF013336 1.0 ug DNA
EUR 354

Kappa Light Chain/ IGKC MonoSpecific Antibody, Unconjugated-20ug

3514-MSM10-P0 20ug
EUR 233

Kappa Light Chain/ IGKC MonoSpecific Antibody, Unconjugated-100ug

3514-MSM10-P1 100ug
EUR 428

IGKC sgRNA CRISPR Lentivector set (Human)

K1049801 3 x 1.0 ug
EUR 339

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC551999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF555 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC551999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF555 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC552050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF555 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC552050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF555 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC552289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF555 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC552289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF555 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC611999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF660R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC611999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF660R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC612050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF660R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC612050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF660R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC612289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF660R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC612289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF660R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC401999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF640R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC401999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF640R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC402050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF640R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC402050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF640R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC402289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF640R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC402289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF640R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC471999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF647 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC471999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF647 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC472050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF647 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC472050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF647 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC472289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF647 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC472289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF647 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC051999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405M conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC051999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405M conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC052050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405M conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC052050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405M conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC052289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405M conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC052289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405M conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC041999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405S conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC041999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405S conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC042050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405S conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC042050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405S conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC042289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405S conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC042289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405S conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC431999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF543 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC431999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF543 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC432050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF543 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC432050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF543 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC432289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF543 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC432289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF543 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNUB1999-100 100uL
EUR 264
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Concentration: 0.2mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNUB1999-50 50uL
EUR 405
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), 1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNUB1999-500 500uL
EUR 513
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Concentration: 0.2mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNUB2050-100 100uL
EUR 264
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Concentration: 0.2mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNUB2050-50 50uL
EUR 405
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), 1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNUB2050-500 500uL
EUR 513
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Concentration: 0.2mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNUB2289-100 100uL
EUR 264
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Concentration: 0.2mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNUB2289-50 50uL
EUR 405
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), 1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNUB2289-500 500uL
EUR 513
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Concentration: 0.2mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC681999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF568 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC681999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF568 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC682050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF568 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC682050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF568 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC682289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF568 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC682289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF568 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC701999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF770 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC701999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF770 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC702050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF770 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC702050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF770 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC702289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF770 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC702289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF770 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC881999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF488A conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC881999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF488A conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC882050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF488A conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC882050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF488A conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC882289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF488A conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC882289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF488A conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC941999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF594 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC941999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF594 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC942050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF594 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC942050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF594 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC942289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF594 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC942289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF594 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNCB1999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Biotin conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNCB1999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Biotin conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNCB2050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Biotin conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNCB2050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Biotin conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNCB2289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Biotin conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNCB2289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Biotin conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNCH1999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNCH1999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNCH2050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNCH2050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNCH2289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNCH2289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC801999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC801999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC802050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC802050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC802289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC802289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680 conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNCP1999-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), PerCP conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNCP2050-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), PerCP conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNCP2289-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), PerCP conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNCR1999-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), RPE conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNCR2050-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), RPE conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNCA1999-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), APC conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNCA2050-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), APC conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNCA2289-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), APC conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNCAP1999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNCAP1999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNCAP2050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNCAP2050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNCAP2289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNCAP2289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC811999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

BNC811999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC812050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

BNC812050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC812289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNC812289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680R conjugate, Concentration: 0.1mg/mL

Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

BNCR2289-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), RPE conjugate, Concentration: 0.1mg/mL

IGKC sgRNA CRISPR Lentivector (Human) (Target 1)

K1049802 1.0 ug DNA
EUR 154

IGKC sgRNA CRISPR Lentivector (Human) (Target 2)

K1049803 1.0 ug DNA
EUR 154

IGKC sgRNA CRISPR Lentivector (Human) (Target 3)

K1049804 1.0 ug DNA
EUR 154

IGKC Protein Vector (Human) (pPB-C-His)

PV053341 500 ng
EUR 481

IGKC Protein Vector (Human) (pPB-N-His)

PV053342 500 ng
EUR 481

IGKC Protein Vector (Human) (pPM-C-HA)

PV053343 500 ng
EUR 481

IGKC Protein Vector (Human) (pPM-C-His)

PV053344 500 ng
EUR 481

IGKC Protein Vector (Human) (pPB-C-His)

PV021073 500 ng
EUR 329

IGKC Protein Vector (Human) (pPB-N-His)

PV021074 500 ng
EUR 329

IGKC Protein Vector (Human) (pPM-C-HA)

PV021075 500 ng
EUR 329

IGKC Protein Vector (Human) (pPM-C-His)

PV021076 500 ng
EUR 329

IGKC Protein Vector (Human) (pPB-C-His)

PV021077 500 ng
EUR 329

IGKC Protein Vector (Human) (pPB-N-His)

PV021078 500 ng
EUR 329

IGKC Protein Vector (Human) (pPM-C-HA)

PV021079 500 ng
EUR 329

IGKC Protein Vector (Human) (pPM-C-His)

PV021080 500 ng
EUR 329

IGKC Protein Vector (Human) (pPB-C-His)

PV021081 500 ng
EUR 329

IGKC Protein Vector (Human) (pPB-N-His)

PV021082 500 ng
EUR 329

IGKC Protein Vector (Human) (pPM-C-HA)

PV021083 500 ng
EUR 329

IGKC Protein Vector (Human) (pPM-C-His)

PV021084 500 ng
EUR 329

IGKC 3'UTR Luciferase Stable Cell Line

TU010772 1.0 ml
EUR 1394

IGKC 3'UTR GFP Stable Cell Line

TU060772 1.0 ml
EUR 1394

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

IGKC Rabbit Polyclonal Antibody