HMGA1 Rabbit Polyclonal Antibody

HMGA1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

HMGA1 Polyclonal Antibody
ABP58799-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HMGA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HMGA1 from Human, Mouse, Rat. This HMGA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HMGA1 protein
HMGA1 Polyclonal Antibody
ABP58799-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HMGA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HMGA1 from Human, Mouse, Rat. This HMGA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HMGA1 protein
HMGA1 Rabbit pAb
A12693-100ul 100 ul
EUR 308
HMGA1 Rabbit pAb
A12693-200ul 200 ul
EUR 459
HMGA1 Rabbit pAb
A12693-20ul 20 ul
EUR 183
HMGA1 Rabbit pAb
A12693-50ul 50 ul
EUR 223
HMGA1 Rabbit mAb
A4343-100ul 100 ul
EUR 410
HMGA1 Rabbit mAb
A4343-200ul 200 ul
EUR 571
HMGA1 Rabbit mAb
A4343-20ul 20 ul
EUR 221
HMGA1 Rabbit mAb
A4343-50ul 50 ul
EUR 287
HMGA1 Rabbit pAb
A1635-100ul 100 ul
EUR 308
HMGA1 Rabbit pAb
A1635-200ul 200 ul
EUR 459
HMGA1 Rabbit pAb
A1635-20ul 20 ul
EUR 183
HMGA1 Rabbit pAb
A1635-50ul 50 ul
EUR 223
Polyclonal HMGIY / HMGA1 Antibody
APG01093G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HMGIY / HMGA1 . This antibody is tested and proven to work in the following applications:
Polyclonal Goat Anti-HMGA1 Antibody
APG00159G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMGA1 . This antibody is tested and proven to work in the following applications:
Polyclonal HMGIY / HMGA1 Antibody (Internal)
APG01040G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HMGIY / HMGA1 (Internal). This antibody is tested and proven to work in the following applications:
Polyclonal HMGA1 Antibody (C-term)
APR06143G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMGA1 (C-term). This antibody is tested and proven to work in the following applications:
HMGA1 Antibody
AF5218 200ul
EUR 304
Description: HMGA1 Antibody detects endogenous levels of total HMGA1.
HMGA1 Antibody
ABF5218 100 ug
EUR 438
HMGA1 antibody
70R-51289 100 ul
EUR 244
Description: Purified Polyclonal HMGA1 antibody
HMGA1 Antibody
47493-100ul 100ul
EUR 252
HMGA1 Antibody
47751-100ul 100ul
EUR 252
HMGA1 Antibody
1-CSB-PA983341
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGA1. Recognizes HMGA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200
HMGA1 Antibody
1-CSB-PA230265
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGA1. Recognizes HMGA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
DLR-HMGA1-c-48T 48T
EUR 570
  • Should the Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates or other biological fluids.
Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
DLR-HMGA1-c-96T 96T
EUR 747
  • Should the Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates or other biological fluids.
Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
DLR-HMGA1-Hu-48T 48T
EUR 517
  • Should the Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
DLR-HMGA1-Hu-96T 96T
EUR 673
  • Should the Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates, cell lysates or other biological fluids.
Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RD-HMGA1-c-48Tests 48 Tests
EUR 581
Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RD-HMGA1-c-96Tests 96 Tests
EUR 809
Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RD-HMGA1-Hu-48Tests 48 Tests
EUR 521
Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RD-HMGA1-Hu-96Tests 96 Tests
EUR 723
Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RDR-HMGA1-c-48Tests 48 Tests
EUR 608
Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RDR-HMGA1-c-96Tests 96 Tests
EUR 847
Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RDR-HMGA1-Hu-48Tests 48 Tests
EUR 544
Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RDR-HMGA1-Hu-96Tests 96 Tests
EUR 756
Polyclonal HMGIY / HMGA1 Antibody (aa1-53)
APR03322G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMGIY / HMGA1 (aa1-53). This antibody is tested and proven to work in the following applications:
HMGA1 Conjugated Antibody
C47493 100ul
EUR 397
HMGA1 Conjugated Antibody
C47751 100ul
EUR 397
Anti-HMGA1 antibody
STJ70745 100 µg
EUR 359
Anti-HMGA1 antibody
STJ28051 100 µl
EUR 277
Description: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.
Anti-HMGA1 antibody
STJ114566 100 µl
EUR 277
Description: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.
Anti-HMGA1 antibody
STJ193001 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HMGA1
Hmga1/ Rat Hmga1 ELISA Kit
ELI-04846r 96 Tests
EUR 886
Polyclonal Goat Anti-HMGA1 (aa9-21) Antibody
APG00158G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMGA1 (aa9-21) . This antibody is tested and proven to work in the following applications:
HMGA1 siRNA
20-abx902480
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HMGA1 siRNA
20-abx919597
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HMGA1 siRNA
20-abx919598
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Anti-HMGA1 (aa9-21) antibody
STJ71997 100 µg
EUR 359
HMGA1 Blocking Peptide
AF5218-BP 1mg
EUR 195
HMGA1 cloning plasmid
CSB-CL010545HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 291
  • Sequence: atgagtgagtcgagctcgaagtccagccagcccttggcctccaagcaggaaaaggacggcactgagaagcggggccggggcaggccgcgcaagcagcctccgaaggagcccagcgaagtgccaacacctaagagacctcggggccgaccaaagggaagcaaaaacaagggtgctgc
  • Show more
Description: A cloning plasmid for the HMGA1 gene.
HMGA1 cloning plasmid
CSB-CL010545HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 324
  • Sequence: atgagtgagtcgagctcgaagtccagccagcccttggcctccaagcaggaaaaggacggcactgagaagcggggccggggcaggccgcgcaagcagcctccggtgagtcccgggacagcgctggtagggagtcagaaggagcccagcgaagtgccaacacctaagagacctcgggg
  • Show more
Description: A cloning plasmid for the HMGA1 gene.
HMGA1 Blocking Peptide
20-abx064164
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Rat HMGA1 shRNA Plasmid
20-abx987402
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human HMGA1 ELISA Kit
ELA-E1478h 96 Tests
EUR 824
Canine HMGA1 ELISA KIT
ELI-04845d 96 Tests
EUR 928
HMGA1 ELISA KIT|Human
EF005799 96 Tests
EUR 689
HMGA1 protein (His tag)
80R-1896 50 ug
EUR 397
Description: Purified recombinant HMGA1 protein
Mouse HMGA1 shRNA Plasmid
20-abx970825
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human HMGA1 shRNA Plasmid
20-abx952156
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
HMGA1 Recombinant Protein (Human)
RP014968 100 ug Ask for price
HMGA1 Recombinant Protein (Human)
RP014971 100 ug Ask for price
HMGA1 Recombinant Protein (Rat)
RP204716 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141815 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141818 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141821 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141824 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141827 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141830 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141833 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141836 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141839 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141842 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141845 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141848 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141851 100 ug Ask for price
HMGA1 Recombinant Protein (Mouse)
RP141854 100 ug Ask for price
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human)
4-PAC050Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1)
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse)
4-PAC050Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1)
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat)
4-PAC050Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1)
HMGA1 ORF Vector (Human) (pORF)
ORF004990 1.0 ug DNA
EUR 95
HMGA1 ORF Vector (Human) (pORF)
ORF004991 1.0 ug DNA
EUR 95
Hmga1 ORF Vector (Rat) (pORF)
ORF068240 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047273 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047274 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047275 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047276 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047277 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047278 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047279 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047280 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047281 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047282 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047283 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047284 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047285 1.0 ug DNA
EUR 506
Hmga1 ORF Vector (Mouse) (pORF)
ORF047286 1.0 ug DNA
EUR 506
Hmga1-rs1 Recombinant Protein (Mouse)
RP141857 100 ug Ask for price
Hmga1-rs1 Recombinant Protein (Mouse)
RP141860 100 ug Ask for price
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), APC
4-PAC050Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), Biotinylated
4-PAC050Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Biotin.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), Cy3
4-PAC050Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Cy3.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), FITC
4-PAC050Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with FITC.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), HRP
4-PAC050Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with HRP.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), PE
4-PAC050Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with PE.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), APC
4-PAC050Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), Biotinylated
4-PAC050Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Biotin.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), Cy3
4-PAC050Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Cy3.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), FITC
4-PAC050Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with FITC.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), HRP
4-PAC050Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with HRP.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), PE
4-PAC050Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with PE.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), APC
4-PAC050Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), Biotinylated
4-PAC050Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Biotin.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), Cy3
4-PAC050Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Cy3.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), FITC
4-PAC050Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with FITC.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), HRP
4-PAC050Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with HRP.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), PE
4-PAC050Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with PE.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), APC-Cy7
4-PAC050Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC-Cy7.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC050Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC-Cy7.
High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), APC-Cy7
4-PAC050Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC-Cy7.
Hmga1 sgRNA CRISPR Lentivector set (Mouse)
K4428901 3 x 1.0 ug
EUR 339
HMGA1 sgRNA CRISPR Lentivector set (Human)
K0969001 3 x 1.0 ug
EUR 339
Hmga1 sgRNA CRISPR Lentivector set (Rat)
K7016301 3 x 1.0 ug
EUR 339
Hmga1-rs1 ORF Vector (Mouse) (pORF)
ORF047287 1.0 ug DNA
EUR 506
Hmga1-rs1 ORF Vector (Mouse) (pORF)
ORF047288 1.0 ug DNA
EUR 506
High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
20-abx104010
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
20-abx104011
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
20-abx104012
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
20-abx172807
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
20-abx172808
  • EUR 940.00
  • EUR 481.00
  • 1 mg
  • 200 ug
  • Please enquire.
High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
20-abx176838
  • EUR 1358.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.
High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
20-abx214938
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
20-abx242352
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

HMGA1 Rabbit Polyclonal Antibody