ELN Rabbit Polyclonal Antibody

ELN Rabbit Polyclonal Antibody

Contact Us Below To Order :

Rat Elastin (ELN) ELISA Kit

DLR-ELN-Ra-96T 96T
EUR 690
  • Should the Rat Elastin (ELN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Elastin (ELN) in samples from serum, plasma or other biological fluids.

Human Elastin (ELN) ELISA Kit

RD-ELN-Hu-48Tests 48 Tests
EUR 500

Human Elastin (ELN) ELISA Kit

RD-ELN-Hu-96Tests 96 Tests
EUR 692

Mouse Elastin (ELN) ELISA Kit

RD-ELN-Mu-48Tests 48 Tests
EUR 511

Mouse Elastin (ELN) ELISA Kit

RD-ELN-Mu-96Tests 96 Tests
EUR 709

Rat Elastin (ELN) ELISA Kit

RD-ELN-Ra-48Tests 48 Tests
EUR 534

Rat Elastin (ELN) ELISA Kit

RD-ELN-Ra-96Tests 96 Tests
EUR 742

Human Elastin (ELN) ELISA Kit

RDR-ELN-Hu-48Tests 48 Tests
EUR 522

Human Elastin (ELN) ELISA Kit

RDR-ELN-Hu-96Tests 96 Tests
EUR 724

Mouse Elastin (ELN) ELISA Kit

RDR-ELN-Mu-48Tests 48 Tests
EUR 534

Mouse Elastin (ELN) ELISA Kit

RDR-ELN-Mu-96Tests 96 Tests
EUR 742

Rat Elastin (ELN) ELISA Kit

RDR-ELN-Ra-48Tests 48 Tests
EUR 558

Rat Elastin (ELN) ELISA Kit

RDR-ELN-Ra-96Tests 96 Tests
EUR 776

ELN Polyclonal Antibody

ES11837-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ELN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ELN Polyclonal Antibody

ES11837-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ELN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ELN Polyclonal Antibody

ABP58473-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ELN protein
  • Applications tips:
Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

ELN Polyclonal Antibody

ABP58473-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ELN protein
  • Applications tips:
Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

ELN Polyclonal Antibody

ABP58473-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ELN protein
  • Applications tips:
Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

ELN Rabbit pAb

A12433-100ul 100 ul
EUR 308

ELN Rabbit pAb

A12433-200ul 200 ul
EUR 459

ELN Rabbit pAb

A12433-20ul 20 ul
EUR 183

ELN Rabbit pAb

A12433-50ul 50 ul
EUR 223

ELN Rabbit pAb

A2723-100ul 100 ul
EUR 308

ELN Rabbit pAb

A2723-200ul 200 ul
EUR 459

ELN Rabbit pAb

A2723-20ul 20 ul
EUR 183

ELN Rabbit pAb

A2723-50ul 50 ul
EUR 223

Rabbit ELN ELISA Kit

ERTE0057 96Tests
EUR 521

Elastin (ELN) Polyclonal Antibody (Human)

4-PAB337Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN)

Elastin (ELN) Polyclonal Antibody (Human)

4-PAB337Hu08
  • EUR 253.00
  • EUR 2615.00
  • EUR 649.00
  • EUR 319.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN)

Elastin (ELN) Polyclonal Antibody (Mouse)

4-PAB337Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN)

ELN Antibody

ABD7064 100 ug
EUR 438

ELN Antibody

35724-100ul 100ul
EUR 252

ELN antibody

38448-100ul 100ul
EUR 252

ELN Antibody

DF7064 200ul
EUR 304
Description: ELN Antibody detects endogenous levels of total ELN.

ELN Antibody

1-CSB-PA591479
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ELN. Recognizes ELN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

ELN Antibody

1-CSB-PA583825
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ELN. Recognizes ELN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

Elastin (ELN) Polyclonal Antibody (Human), APC

4-PAB337Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

Elastin (ELN) Polyclonal Antibody (Human), Biotinylated

4-PAB337Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

Elastin (ELN) Polyclonal Antibody (Human), Cy3

4-PAB337Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

Elastin (ELN) Polyclonal Antibody (Human), FITC

4-PAB337Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

Elastin (ELN) Polyclonal Antibody (Human), HRP

4-PAB337Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

Elastin (ELN) Polyclonal Antibody (Human), PE

4-PAB337Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

Elastin (ELN) Polyclonal Antibody (Human), APC

4-PAB337Hu08-APC
  • EUR 355.00
  • EUR 3419.00
  • EUR 948.00
  • EUR 454.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

Elastin (ELN) Polyclonal Antibody (Human), Biotinylated

4-PAB337Hu08-Biotin
  • EUR 318.00
  • EUR 2565.00
  • EUR 753.00
  • EUR 391.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

Elastin (ELN) Polyclonal Antibody (Human), Cy3

4-PAB337Hu08-Cy3
  • EUR 432.00
  • EUR 4517.00
  • EUR 1223.00
  • EUR 564.00
  • EUR 257.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

Elastin (ELN) Polyclonal Antibody (Human), FITC

4-PAB337Hu08-FITC
  • EUR 304.00
  • EUR 2755.00
  • EUR 778.00
  • EUR 383.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

Elastin (ELN) Polyclonal Antibody (Human), HRP

4-PAB337Hu08-HRP
  • EUR 324.00
  • EUR 2979.00
  • EUR 838.00
  • EUR 410.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

Elastin (ELN) Polyclonal Antibody (Human), PE

4-PAB337Hu08-PE
  • EUR 304.00
  • EUR 2755.00
  • EUR 778.00
  • EUR 383.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

Elastin (ELN) Polyclonal Antibody (Mouse), APC

4-PAB337Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with APC.

Elastin (ELN) Polyclonal Antibody (Mouse), Biotinylated

4-PAB337Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with Biotin.

Elastin (ELN) Polyclonal Antibody (Mouse), Cy3

4-PAB337Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with Cy3.

Elastin (ELN) Polyclonal Antibody (Mouse), FITC

4-PAB337Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with FITC.

Elastin (ELN) Polyclonal Antibody (Mouse), HRP

4-PAB337Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with HRP.

Elastin (ELN) Polyclonal Antibody (Mouse), PE

4-PAB337Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with PE.

Rabbit Elastin (ELN) ELISA Kit

abx354258-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELN Conjugated Antibody

C38448 100ul
EUR 397

ELN Conjugated Antibody

C35724 100ul
EUR 397

Elastin (ELN) Antibody

20-abx132104
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Elastin (ELN) Antibody

20-abx002068
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Elastin (ELN) Antibody

20-abx146903
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Elastin (ELN) Antibody

20-abx132220
  • EUR 439.00
  • EUR 133.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Elastin (ELN) Antibody

20-abx100085
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Elastin (ELN) Antibody

20-abx100086
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Elastin (ELN) Antibody

20-abx100087
  • EUR 829.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Elastin (ELN) Antibody

20-abx007872
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Elastin (ELN) Antibody

20-abx172209
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Elastin (ELN) Antibody

20-abx176238
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Elastin (ELN) Antibody

20-abx176239
  • EUR 1247.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Elastin (ELN) Antibody

20-abx339544
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Elastin (ELN) Antibody

20-abx211321
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-ELN antibody

STJ23529 100 µl
EUR 277
Description: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ELN antibody

STJ114307 100 µl
EUR 277
Description: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ELN antibody

STJ192995 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ELN

ELN/ Rat ELN ELISA Kit

ELA-E1337r 96 Tests
EUR 886

Eln/ Rat Eln ELISA Kit

ELI-04404r 96 Tests
EUR 886

Elastin (ELN) Polyclonal Antibody (Human), APC-Cy7

4-PAB337Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7.

Elastin (ELN) Polyclonal Antibody (Human), APC-Cy7

4-PAB337Hu08-APC-Cy7
  • EUR 590.00
  • EUR 6718.00
  • EUR 1777.00
  • EUR 788.00
  • EUR 328.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7.

Elastin (ELN) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB337Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with APC-Cy7.

ELISA kit for Rabbit ELN (Elastin)

E-EL-RB0506 1 plate of 96 wells
EUR 584
  • Gentaur's ELN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rabbit ELN. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rabbit ELN (Elastin) in samples from Serum, Plasma, Cell supernatant

ELN siRNA

20-abx901701
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ELN-441958

HY-15043 10mg
EUR 739

ELN siRNA

20-abx915285
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ELN siRNA

20-abx915286
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Elastin (ELN) Antibody (FITC)

20-abx273707
  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Elastin (ELN) Antibody Pair

20-abx370672
  • EUR 1664.00
  • EUR 1066.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Elastin (ELN) Antibody (FITC)

20-abx271077
  • EUR 467.00
  • EUR 244.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Elastin (ELN) Antibody (Biotin)

20-abx271340
  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Elastin (ELN) Antibody (Biotin)

20-abx272127
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Elastin (ELN) Monoclonal Antibody (Human)

4-MAB337Hu21
  • EUR 247.00
  • EUR 2523.00
  • EUR 628.00
  • EUR 311.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly392~Ala645
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN)

ELN cloning plasmid

CSB-CL007617HU-10ug 10ug
EUR 663
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1977
  • Sequence: atggcgggtctgacggcggcggccccgcggcccggagtcctcctgctcctgctgtccatcctccacccctctcggcctggaggggtccctggggccattcctggtggagttcctggaggagtcttttatccaggggctggtctcggagcccttggaggaggagcgctggggcctg
  • Show more
Description: A cloning plasmid for the ELN gene.

ELN 318463 racemate

HY-50882A 5mg
EUR 601

ELN Blocking Peptide

DF7064-BP 1mg
EUR 195

Recombinant Elastin (ELN)

4-RPB337Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P15502
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.9kDa
  • Isoelectric Point: 10.3
Description: Recombinant Human Elastin expressed in: E.coli

Recombinant Elastin (ELN)

4-RPB337Mu01
  • EUR 499.62
  • EUR 236.00
  • EUR 1598.56
  • EUR 599.52
  • EUR 1099.04
  • EUR 397.00
  • EUR 3846.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P54320
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.3kDa
  • Isoelectric Point: 9
Description: Recombinant Mouse Elastin expressed in: E.coli

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC551981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF555 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC551981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF555 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC611981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF660R conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC611981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF660R conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC401981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF640R conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC401981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF640R conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC471981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF647 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC471981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF647 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC051981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405M conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC051981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405M conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC041981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405S conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC041981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405S conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC431981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF543 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC431981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF543 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNUB1981-100 100uL
EUR 264
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Concentration: 0.2mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNUB1981-50 50uL
EUR 405
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), 1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNUB1981-500 500uL
EUR 513
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Concentration: 0.2mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC681981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF568 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC681981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF568 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC701981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF770 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC701981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF770 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC881981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF488A conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC881981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF488A conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC941981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF594 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC941981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF594 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNCB1981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Biotin conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNCB1981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Biotin conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNCH1981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNCH1981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC801981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC801981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNCP1981-250 250uL
EUR 394
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), PerCP conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNCR1981-250 250uL
EUR 394
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), RPE conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNCA1981-250 250uL
EUR 394
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), APC conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNCAP1981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNCAP1981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC811981-100 100uL
EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680R conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNC811981-500 500uL
EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680R conjugate, Concentration: 0.1mg/mL

Elastin (ELN) MonoSpecific Antibody, Unconjugated-20ug

2006-MSM1-P0 20ug
EUR 233

Elastin (ELN) MonoSpecific Antibody, Unconjugated-100ug

2006-MSM1-P1 100ug
EUR 428

Elastin (ELN) Monoclonal Antibody (Human), APC

4-MAB337Hu21-APC
  • EUR 346.00
  • EUR 3293.00
  • EUR 917.00
  • EUR 441.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly392~Ala645
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

Elastin (ELN) Monoclonal Antibody (Human), Biotinylated

4-MAB337Hu21-Biotin
  • EUR 312.00
  • EUR 2473.00
  • EUR 730.00
  • EUR 382.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly392~Ala645
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

Elastin (ELN) Monoclonal Antibody (Human), Cy3

4-MAB337Hu21-Cy3
  • EUR 420.00
  • EUR 4349.00
  • EUR 1181.00
  • EUR 547.00
  • EUR 252.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly392~Ala645
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

Elastin (ELN) Monoclonal Antibody (Human), FITC

4-MAB337Hu21-FITC
  • EUR 297.00
  • EUR 2654.00
  • EUR 753.00
  • EUR 373.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly392~Ala645
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

Elastin (ELN) Monoclonal Antibody (Human), HRP

4-MAB337Hu21-HRP
  • EUR 316.00
  • EUR 2870.00
  • EUR 811.00
  • EUR 399.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly392~Ala645
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

Elastin (ELN) Monoclonal Antibody (Human), PE

4-MAB337Hu21-PE
  • EUR 297.00
  • EUR 2654.00
  • EUR 753.00
  • EUR 373.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly392~Ala645
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

Rat Elastin (ELN) Protein

20-abx653250
  • EUR 746.00
  • EUR 300.00
  • EUR 2332.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat ELN shRNA Plasmid

20-abx984755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ELN ELISA Kit

EHE0057 96Tests
EUR 521

Human ELN ELISA Kit

ELA-E1337h 96 Tests
EUR 824

Goat ELN ELISA Kit

EGTE0057 96Tests
EUR 521

Canine ELN ELISA Kit

ECE0057 96Tests
EUR 521

Chicken ELN ELISA Kit

ECKE0057 96Tests
EUR 521

Bovine ELN ELISA Kit

EBE0057 96Tests
EUR 521

Anserini ELN ELISA Kit

EAE0057 96Tests
EUR 521

ELN ELISA KIT|Human

EF005387 96 Tests
EUR 689

Porcine ELN ELISA Kit

EPE0057 96Tests
EUR 521

Rat ELN ELISA Kit

ERE0057 96Tests
EUR 521

Sheep ELN ELISA Kit

ESE0057 96Tests
EUR 521

Mouse ELN ELISA Kit

EME0057 96Tests
EUR 521

Monkey ELN ELISA Kit

EMKE0057 96Tests
EUR 521

Human Elastin (ELN) Protein

20-abx066394
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Elastin (ELN) Protein

20-abx066395
  • EUR 704.00
  • EUR 286.00
  • EUR 2151.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human ELN shRNA Plasmid

20-abx951389
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ELN shRNA Plasmid

20-abx970158
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OVA Conjugated Elastin (ELN)

4-CPB337Hu21
  • EUR 226.34
  • EUR 163.00
  • EUR 573.76
  • EUR 257.92
  • EUR 415.84
  • EUR 214.00
  • EUR 1284.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P15502
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Elastin expressed in: chemical synthesis

KLH conjugated Elastin (ELN)

4-CPB337Hu31
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P15502
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Elastin expressed in: chemical synthesis

Elastin (ELN) Monoclonal Antibody (Human), APC-Cy7

4-MAB337Hu21-APC-Cy7
  • EUR 572.00
  • EUR 6466.00
  • EUR 1714.00
  • EUR 763.00
  • EUR 320.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly392~Ala645
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7.

Cow Elastin (ELN) ELISA Kit

abx516439-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Elastin (ELN) ELISA Kit

abx516440-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Elastin (ELN) CLIA Kit

20-abx496590
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Elastin (ELN) ELISA Kit

20-abx585051
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Elastin (ELN) ELISA Kit

abx570725-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Elastin (ELN) ELISA Kit

abx573212-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Elastin (ELN) ELISA Kit

abx575582-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Eln/ Elastin ELISA Kit

E0324Ra 1 Kit
EUR 571

Guinea Pig ELN ELISA Kit

EGE0057 96Tests
EUR 521

Human ELN/ Elastin ELISA Kit

E0779Hu 1 Kit
EUR 571

Human ELN(Elastin) ELISA Kit

EH1505 96T
EUR 524.1
  • Detection range: 0.469-30 ng/ml
  • Uniprot ID: P15502
  • Alias: ELN(Elastin)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.281 ng/ml

Human Elastin, ELN ELISA KIT

ELI-04402h 96 Tests
EUR 824

Bovine Elastin, ELN ELISA KIT

ELI-04403b 96 Tests
EUR 928

Chicken Elastin, ELN ELISA KIT

ELI-04405c 96 Tests
EUR 928

Mouse Elastin, Eln ELISA KIT

ELI-04406m 96 Tests
EUR 865

Mouse Elastin(ELN)ELISA Kit

GA-E0981MS-48T 48T
EUR 336

Mouse Elastin(ELN)ELISA Kit

GA-E0981MS-96T 96T
EUR 534

Human Elastin(ELN)ELISA Kit

GA-E1491HM-48T 48T
EUR 289

Human Elastin(ELN)ELISA Kit

GA-E1491HM-96T 96T
EUR 466

Rat Eln(Elastin) ELISA Kit

ER0508 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q99372
  • Alias: Eln
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml

Mouse ELN(Elastin) ELISA Kit

EM1002 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P54320
  • Alias: ELN
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Rat Elastin (ELN) ELISA Kit

20-abx155465
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Elastin (ELN) ELISA Kit

20-abx153951
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Elastin (ELN) ELISA Kit

20-abx151397
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Elastin (ELN) ELISA Kit

abx051363-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Pig Elastin (ELN) ELISA Kit

abx353422-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Dog Elastin (ELN) ELISA Kit

abx354620-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Chicken Elastin (ELN) ELISA Kit

abx354750-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Elastin (ELN) ELISA Kit

abx354963-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Elastin (ELN) ELISA Kit

abx355373-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Human Elastin (ELN) CLIA Kit

20-abx492661
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Elastin (ELN) CLIA Kit

20-abx492662
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Elastin (ELN) CLIA Kit

20-abx492663
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Elastin (ELN) ELISA Kit

abx256485-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Elastin (ELN) ELISA Kit

abx250788-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Elastin (ELN) ELISA Kit

abx254055-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Elastin (ELN) CLIA Kit

abx196626-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Elastin (ELN) CLIA Kit

abx196926-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Elastin (ELN) CLIA Kit

abx196927-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Elastin,ELN ELISA Kit

201-12-1475 96 tests
EUR 440
  • This Elastin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Pig Elastin (ELN) ELISA Kit

CSB-E15814p-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig Elastin (ELN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Pig Elastin (ELN) ELISA Kit

1-CSB-E15814p
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig Elastin (ELN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Elastin(ELN) ELISA kit

CSB-EL007617MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Elastin (ELN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Elastin(ELN) ELISA kit

1-CSB-EL007617MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Elastin(ELN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Elastin, ELN ELISA Kit

CSB-E09338h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Elastin, ELN in samples from serum, plasma, cell culture supernates, tissue homogenates, cell lysates, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Elastin, ELN ELISA Kit

1-CSB-E09338h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Elastin, ELN in samples from serum, plasma, cell culture supernates, tissue homogenates, cell lysates, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Chicken ELN/ Elastin ELISA Kit

E0022Ch 1 Kit
EUR 717

ELN ORF Vector (Human) (pORF)

ORF003534 1.0 ug DNA
EUR 95

Eln ORF Vector (Rat) (pORF)

ORF066505 1.0 ug DNA
EUR 506

Eln ORF Vector (Mouse) (pORF)

ORF043851 1.0 ug DNA
EUR 506

Human Elastin (ELN) ELISA Kit

SEB337Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Elastin (ELN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Elastin (ELN) ELISA Kit

SEB337Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Elastin (ELN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Elastin (ELN) ELISA Kit

SEB337Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Elastin (ELN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Elastin (ELN) ELISA Kit

SEB337Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Elastin (ELN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Elastin (ELN) ELISA Kit

4-SEB337Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Elastin elisa. Alternative names of the recognized antigen: WBS, WS, SVAS
  • Tropoelastin
  • Supravalvular Aortic Stenosis
  • Williams-Beuren Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Elastin (ELN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Elastin (ELN) ELISA Kit

SEB337Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Elastin (ELN) in serum, plasma and other biological fluids.

Mouse Elastin (ELN) ELISA Kit

SEB337Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Elastin (ELN) in serum, plasma and other biological fluids.

Mouse Elastin (ELN) ELISA Kit

SEB337Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Elastin (ELN) in serum, plasma and other biological fluids.

Mouse Elastin (ELN) ELISA Kit

SEB337Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Elastin (ELN) in serum, plasma and other biological fluids.

Mouse Elastin (ELN) ELISA Kit

4-SEB337Mu
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Elastin elisa. Alternative names of the recognized antigen: WBS, WS, SVAS
  • Tropoelastin
  • Supravalvular Aortic Stenosis
  • Williams-Beuren Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Elastin (ELN) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Elastin (ELN) ELISA Kit

SEB337Ra-10x96wellstestplate 10x96-wells test plate
EUR 4875.49
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Elastin (ELN) in serum, plasma and other biological fluids.

Rat Elastin (ELN) ELISA Kit

SEB337Ra-1x48wellstestplate 1x48-wells test plate
EUR 489.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Elastin (ELN) in serum, plasma and other biological fluids.

Rat Elastin (ELN) ELISA Kit

SEB337Ra-1x96wellstestplate 1x96-wells test plate
EUR 655.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Elastin (ELN) in serum, plasma and other biological fluids.

Rat Elastin (ELN) ELISA Kit

SEB337Ra-5x96wellstestplate 5x96-wells test plate
EUR 2651.73
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Elastin (ELN) in serum, plasma and other biological fluids.

Rat Elastin (ELN) ELISA Kit

4-SEB337Ra
  • EUR 4926.00
  • EUR 2602.00
  • EUR 656.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Elastin elisa. Alternative names of the recognized antigen: WBS, WS, SVAS
  • Tropoelastin
  • Supravalvular Aortic Stenosis
  • Williams-Beuren Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Elastin (ELN) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Elastin ELISA Kit (ELN)

RK01307 96 Tests
EUR 521

Human Elastin(ELN)ELISA Kit

QY-E03904 96T
EUR 394

Human Elastin (ELN)ELISA Kit

QY-E05297 96T
EUR 394

Rat Elastin(ELN)ELISA Kit

QY-E10331 96T
EUR 361

Mouse Elastin(ELN)ELISA Kit

QY-E20511 96T
EUR 361

pECMV-Eln-m-FLAG Plasmid

PVT15283 2 ug
EUR 325

ELISA kit for Mouse ELN (Elastin)

E-EL-M0446 1 plate of 96 wells
EUR 534
  • Gentaur's ELN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ELN. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ELN (Elastin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse ELN (Elastin)

ELK3178 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Elastin (ELN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Elastin (ELN). Next,
  • Show more
Description: A sandwich ELISA kit for detection of Elastin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat ELN (Elastin)

ELK5957 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Elastin (ELN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Elastin (ELN). Next,
  • Show more
Description: A sandwich ELISA kit for detection of Elastin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELN Rabbit Polyclonal Antibody