MVP Rabbit Polyclonal Antibody

MVP Rabbit Polyclonal Antibody

Contact Us Below To Order :

MVP Polyclonal Antibody

ABP59347-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MVP protein
  • Applications tips:
Description: A polyclonal antibody for detection of MVP from Human, Mouse, Rat. This MVP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MVP protein

MVP Polyclonal Antibody

ES11827-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MVP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MVP Polyclonal Antibody

ES11827-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MVP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Major Vault Protein (MVP) ELISA Kit

DLR-MVP-Hu-48T 48T
EUR 517
  • Should the Human Major Vault Protein (MVP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Major Vault Protein (MVP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Major Vault Protein (MVP) ELISA Kit

DLR-MVP-Hu-96T 96T
EUR 673
  • Should the Human Major Vault Protein (MVP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Major Vault Protein (MVP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Major Vault Protein (MVP) ELISA Kit

RDR-MVP-Hu-48Tests 48 Tests
EUR 544

Human Major Vault Protein (MVP) ELISA Kit

RDR-MVP-Hu-96Tests 96 Tests
EUR 756

Human Major Vault Protein (MVP) ELISA Kit

RD-MVP-Hu-48Tests 48 Tests
EUR 521

Human Major Vault Protein (MVP) ELISA Kit

RD-MVP-Hu-96Tests 96 Tests
EUR 723

MVP Rabbit pAb

A1980-100ul 100 ul
EUR 308

MVP Rabbit pAb

A1980-200ul 200 ul
EUR 459

MVP Rabbit pAb

A1980-20ul 20 ul
EUR 183

MVP Rabbit pAb

A1980-50ul 50 ul
EUR 223

Rabbit MVP ELISA Kit

ERTM0362 96Tests
EUR 521

Polyclonal MVP Antibody (N-term)

APR08581G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MVP (N-term). This antibody is tested and proven to work in the following applications:

MVP Polyclonal Antibody, HRP Conjugated

A56484 100 µg
EUR 570.55
Description: kits suitable for this type of research

MVP Polyclonal Antibody, FITC Conjugated

A56485 100 µg
EUR 570.55
Description: fast delivery possible

MVP Polyclonal Antibody, Biotin Conjugated

A56486 100 µg
EUR 570.55
Description: reagents widely cited

MVP antibody

70R-18687 50 ul
EUR 435
Description: Rabbit polyclonal MVP antibody

MVP antibody

70R-13556 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal MVP antibody

MVP antibody

70R-2052 50 ug
EUR 467
Description: Rabbit polyclonal MVP antibody raised against the N terminal of MVP

MVP Antibody

32533-100ul 100ul
EUR 252

MVP Antibody

49659-100ul 100ul
EUR 333

MVP Antibody

49659-50ul 50ul
EUR 239

MVP Antibody

49662-100ul 100ul
EUR 333

MVP Antibody

49662-50ul 50ul
EUR 239

MVP Antibody

1-CSB-PA110757
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

MVP Antibody

DF6732 200ul
EUR 304
Description: MVP Antibody detects endogenous levels of total MVP.

MVP Antibody

1-CSB-PA015248GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MVP Antibody

1-CSB-PA015248LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000

MVP Antibody

1-CSB-PA018595
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

MVP Antibody

ABD6732 100 ug
EUR 438

Polyclonal MVP / VAULT1 Antibody (aa878-893)

APR02315G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MVP / VAULT1 (aa878-893). This antibody is tested and proven to work in the following applications:

Major vault protein (MVP) polyclonal antibody

ABP-PAB-10900 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

LRP(MVP) antibody

22901-100ul 100ul
EUR 390

Anti-MVP Antibody

A00642-1 100ug/vial
EUR 334

MVP Conjugated Antibody

C49659 100ul
EUR 397

MVP Conjugated Antibody

C32533 100ul
EUR 397

MVP / LRP Antibody

abx235449-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-MVP antibody

STJ24649 100 µl
EUR 277
Description: This gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The encoded protein may play a role in multiple cellular processes by regulating the MAP kinase, JAK/STAT and phosphoinositide 3-kinase/Akt signaling pathways. The encoded protein also plays a role in multidrug resistance, and expression of this gene may be a prognostic marker for several types of cancer. Alternatively spliced transcript variants have been observed for this gene.

Anti-MVP antibody

STJ192985 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MVP

Mvp/ Rat Mvp ELISA Kit

ELI-03488r 96 Tests
EUR 886

Major Vault Protein (MVP) Polyclonal Antibody (Human)

4-PAB764Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP)

MVP siRNA

20-abx925067
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MVP siRNA

20-abx925068
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MVP Antibody, HRP conjugated

1-CSB-PA015248LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MVP Antibody, FITC conjugated

1-CSB-PA015248LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MVP Antibody, Biotin conjugated

1-CSB-PA015248LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MVP recombinant monoclonal antibody

A5824 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human MVP for WB,ELISA

anti- MVP/LRP antibody

FNab05449 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: major vault protein
  • Uniprot ID: Q14764
  • Gene ID: 9961
  • Research Area: Cancer, Metabolism
Description: Antibody raised against MVP/LRP

Anti-MVP/LRP antibody

PAab05449 100 ug
EUR 355

Anti-LRP/MVP antibody

STJ16100893 1 mL
EUR 478

Anti-LRP/MVP antibody

STJ16100902 1 mL
EUR 478

Anti-MVP/LRP antibody

STJ16100910 100 µg
EUR 354

Anti-MVP/LRP antibody

STJ16100911 100 µg
EUR 354

Anti-MVP/LRP antibody

STJ16100912 100 µg
EUR 354

Major Vault Protein (MVP) Polyclonal Antibody (Human), APC

4-PAB764Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with APC.

Major Vault Protein (MVP) Polyclonal Antibody (Human), Biotinylated

4-PAB764Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with Biotin.

Major Vault Protein (MVP) Polyclonal Antibody (Human), Cy3

4-PAB764Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with Cy3.

Major Vault Protein (MVP) Polyclonal Antibody (Human), FITC

4-PAB764Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with FITC.

Major Vault Protein (MVP) Polyclonal Antibody (Human), HRP

4-PAB764Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with HRP.

Major Vault Protein (MVP) Polyclonal Antibody (Human), PE

4-PAB764Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with PE.

Rabbit Major Vault Protein (MVP) ELISA Kit

abx362163-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Major Vault Protein (MVP) Antibody

abx025511-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody

20-abx113585
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody

20-abx129080
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Major Vault Protein (MVP) Antibody

20-abx109322
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody

20-abx173444
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Major Vault Protein (MVP) Antibody

abx032736-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody

abx032736-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody

abx033927-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody

abx033927-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody

20-abx241893
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody

20-abx242151
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody

20-abx225299
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody

20-abx001613
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-MVP Antibody (monoclonal, 8B12)

M00642-1 100ug/vial
EUR 334

MVP Blocking Peptide

33R-5769 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MVP antibody, catalog no. 70R-2052

MVP Blocking Peptide

DF6732-BP 1mg
EUR 195

MVP cloning plasmid

CSB-CL015248HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2682
  • Sequence: atggcaactgaagagttcatcatccgcatccccccataccactatatccatgtgctggaccagaacagcaacgtgtcccgtgtggaggtcgggccaaagacctacatccggcaggacaatgagagggtactgtttgcccccatgcgcatggtgaccgtccccccacgtcactact
  • Show more
Description: A cloning plasmid for the MVP gene.

Major Vault Protein (MVP) Polyclonal Antibody (Human), APC-Cy7

4-PAB764Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with APC-Cy7.

Major Vault Protein (MVP) Antibody (Biotin)

20-abx105646
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody (FITC)

20-abx107063
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody (HRP)

20-abx108484
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Major Vault Protein (MVP) (VP2897R) Antibody

BNCR2897-250 250uL
EUR 394
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), RPE conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNUB0224-100 100uL
EUR 209
Description: Primary antibody against Major Vault Protein (MVP)(1014), Concentration: 0.2mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNUB0224-500 500uL
EUR 458
Description: Primary antibody against Major Vault Protein (MVP)(1014), Concentration: 0.2mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNUB0225-100 100uL
EUR 209
Description: Primary antibody against Major Vault Protein (MVP)(1032), Concentration: 0.2mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNUB0225-500 500uL
EUR 458
Description: Primary antibody against Major Vault Protein (MVP)(1032), Concentration: 0.2mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNUB2897-100 100uL
EUR 264
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Concentration: 0.2mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNUB2897-50 50uL
EUR 405
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), 1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNUB2897-500 500uL
EUR 513
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Concentration: 0.2mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNUM0224-50 50uL
EUR 395
Description: Primary antibody against Major Vault Protein (MVP)(1014), 1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNUM0225-50 50uL
EUR 395
Description: Primary antibody against Major Vault Protein (MVP)(1032), 1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC040224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF405S conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC040224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF405S conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC040225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF405S conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC040225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF405S conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC552897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF555 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC552897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF555 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC610224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF660R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC610224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF660R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC610225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF660R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC610225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF660R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC432897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF543 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC432897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF543 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC470224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF647 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC470224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF647 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC470225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF647 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC470225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF647 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC472897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF647 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC472897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF647 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC550224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF555 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC550224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF555 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC550225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF555 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC550225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF555 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC042897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF405S conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC042897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF405S conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC050224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF405M conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC050224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF405M conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC050225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF405M conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC050225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF405M conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC052897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF405M conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC052897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF405M conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC400224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF640R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC400224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF640R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC400225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF640R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC400225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF640R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC402897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF640R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC402897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF640R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC430224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF543 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC430224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF543 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC430225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF543 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC430225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF543 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC702897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF770 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC702897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF770 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC800224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF680 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC800224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF680 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC800225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF680 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC800225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF680 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC802897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF680 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC802897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF680 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC810224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF680R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC810224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF680R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC810225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF680R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC810225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF680R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNCH2897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNCH2897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNCP0224-250 250uL
EUR 383
Description: Primary antibody against Major Vault Protein (MVP)(1014), PerCP conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNCP0225-250 250uL
EUR 383
Description: Primary antibody against Major Vault Protein (MVP)(1032), PerCP conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNCP2897-250 250uL
EUR 394
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), PerCP conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNCR0224-250 250uL
EUR 383
Description: Primary antibody against Major Vault Protein (MVP)(1014), RPE conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNCR0225-250 250uL
EUR 383
Description: Primary antibody against Major Vault Protein (MVP)(1032), RPE conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC942897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF594 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC942897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF594 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNCA0224-250 250uL
EUR 383
Description: Primary antibody against Major Vault Protein (MVP)(1014), APC conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNCA0225-250 250uL
EUR 383
Description: Primary antibody against Major Vault Protein (MVP)(1032), APC conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNCA2897-250 250uL
EUR 394
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), APC conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNCAP0224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNCAP0224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNCAP0225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNCAP0225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNCB2897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Biotin conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNCB2897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Biotin conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNCH0224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNCH0224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNCH0225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNCH0225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC882897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF488A conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC882897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF488A conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC940224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF594 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC940224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF594 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC940225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF594 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC940225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF594 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC682897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF568 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC682897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF568 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC700224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF770 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC700224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF770 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC700225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF770 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC700225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF770 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNCAP2897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNCAP2897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNCB0224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), Biotin conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNCB0224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), Biotin conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNCB0225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), Biotin conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNCB0225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), Biotin conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC812897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF680R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC812897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF680R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC880224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF488A conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC880224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF488A conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC880225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF488A conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC880225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF488A conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC612897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF660R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody

BNC612897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF660R conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC680224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF568 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody

BNC680224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF568 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC680225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF568 conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody

BNC680225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF568 conjugate, Concentration: 0.1mg/mL

Human MVP ELISA Kit

ELA-E1071h 96 Tests
EUR 824

Human MVP ELISA Kit

EHM0362 96Tests
EUR 521

Bovine MVP ELISA Kit

EBM0362 96Tests
EUR 521

Anserini MVP ELISA Kit

EAM0362 96Tests
EUR 521

Canine MVP ELISA Kit

ECM0362 96Tests
EUR 521

Goat MVP ELISA Kit

EGTM0362 96Tests
EUR 521

MVP ELISA KIT|Human

EF008745 96 Tests
EUR 689

Rat MVP shRNA Plasmid

20-abx986339
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MVP shRNA Plasmid

20-abx956699
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine MVP ELISA Kit

EPM0362 96Tests
EUR 521

Rat MVP ELISA Kit

ERM0362 96Tests
EUR 521

Mouse MVP ELISA Kit

EMM0362 96Tests
EUR 521

Anti-MVP (2H3-1A6)

YF-MA11228 100 ug
EUR 363
Description: Mouse monoclonal to MVP

Anti-Major Vault Protein (MVP) Monoclonal Antibody

M00642 100ug/vial
EUR 397
Description: Mouse Monoclonal Major Vault Protein (MVP) Antibody. Validated in IHC and tested in Human.

Human Major vault protein (MVP)

1-CSB-EP015248HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 115.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Major vault protein(MVP) expressed in E.coli

Guinea Pig MVP ELISA Kit

EGM0362 96Tests
EUR 521

Mvp ORF Vector (Rat) (pORF)

ORF070944 1.0 ug DNA
EUR 506

MVP ORF Vector (Human) (pORF)

ORF006807 1.0 ug DNA
EUR 95

MVP Rabbit Polyclonal Antibody