UCP1 Rabbit Polyclonal Antibody

UCP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

UCP1 Polyclonal Antibody
ABP60848-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein
UCP1 Polyclonal Antibody
ABP60848-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein
UCP1 Polyclonal Antibody
ES11824-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against UCP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
UCP1 Polyclonal Antibody
ES11824-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UCP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
UCP1 Rabbit pAb
A5857-100ul 100 ul
EUR 308
UCP1 Rabbit pAb
A5857-200ul 200 ul
EUR 459
UCP1 Rabbit pAb
A5857-20ul 20 ul
EUR 183
UCP1 Rabbit pAb
A5857-50ul 50 ul
EUR 223
UCP1 Rabbit pAb
A7236-100ul 100 ul
EUR 384
UCP1 Rabbit pAb
A7236-200ul 200 ul Ask for price
UCP1 Rabbit pAb
A7236-20ul 20 ul
EUR 183
UCP1 Rabbit pAb
A7236-50ul 50 ul
EUR 265
Anti-UCP1/UCP1 Antibody
A00255 100ug/vial
EUR 294
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Hu-48T 48T
EUR 517
  • Should the Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Hu-96T 96T
EUR 673
  • Should the Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Mu-48T 48T
EUR 527
  • Should the Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Mu-96T 96T
EUR 688
  • Should the Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Ra-48T 48T
EUR 549
  • Should the Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Ra-96T 96T
EUR 718
  • Should the Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Hu-48Tests 48 Tests
EUR 544
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Hu-96Tests 96 Tests
EUR 756
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Mu-48Tests 48 Tests
EUR 557
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Mu-96Tests 96 Tests
EUR 774
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Ra-48Tests 48 Tests
EUR 583
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Ra-96Tests 96 Tests
EUR 811
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Hu-48Tests 48 Tests
EUR 521
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Hu-96Tests 96 Tests
EUR 723
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Mu-48Tests 48 Tests
EUR 533
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Mu-96Tests 96 Tests
EUR 740
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Ra-48Tests 48 Tests
EUR 557
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Ra-96Tests 96 Tests
EUR 775
Polyclonal Goat Anti-UCP1 Antibody
AMM05152G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-UCP1 . This antibody is tested and proven to work in the following applications:
UCP1 Polyclonal Antibody, Biotin Conjugated
A54903 100 µg
EUR 570.55
Description: reagents widely cited
UCP1 Polyclonal Antibody, FITC Conjugated
A54904 100 µg
EUR 570.55
Description: Ask the seller for details
UCP1 Polyclonal Antibody, HRP Conjugated
A54905 100 µg
EUR 570.55
Description: The best epigenetics products
UCP1 Antibody
6637-50
EUR 414
UCP1 antibody
38698-100ul 100ul
EUR 252
UCP1 Antibody
43429-100ul 100ul
EUR 252
UCP1 Antibody
DF7720 200ul
EUR 304
Description: UCP1 Antibody detects endogenous levels of total UCP1.
UCP1 Antibody
1-CSB-PA216676
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150
UCP1 antibody
70R-UR001 100 ug
EUR 640
Description: Affinity purified Rabbit polyclonal UCP1 antibody
UCP1 Antibody
1-CSB-PA025554ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
UCP1 Antibody
1-CSB-PA025554ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
UCP1 Antibody
1-CSB-PA025554LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
UCP1 Antibody
ABD7720 100 ug
EUR 438
Polyclonal UCP1 antibody - N-terminal region
APR10648G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 - N-terminal region. This antibody is tested and proven to work in the following applications:
UCP1 Conjugated Antibody
C38698 100ul
EUR 397
anti- UCP1 antibody
FNab09227 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: uncoupling protein 1(mitochondrial, proton carrier)
  • Uniprot ID: P25874
  • Gene ID: 7350
  • Research Area: Metabolism
Description: Antibody raised against UCP1
Anti-UCP1 Antibody
PA1981 100ug/vial
EUR 294
Anti-UCP1 Antibody
PA1982 100ug/vial
EUR 294
Anti-UCP1 antibody
PAab09227 100 ug
EUR 386
Anti-UCP1 antibody
STJ11100933 100 µl
EUR 393
Description: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.
Anti-UCP1 antibody
STJ28420 100 µl
EUR 277
Description: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.
Anti-UCP1 antibody
STJ192982 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UCP1
Anti-UCP1 antibody
STJ70810 100 µg
EUR 359
Ucp1/ Rat Ucp1 ELISA Kit
ELI-06632r 96 Tests
EUR 886
Polyclonal UCP1 / UCP-1 Antibody (C-Terminus)
APR10643G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 / UCP-1 (C-Terminus). This antibody is tested and proven to work in the following applications:
UCP1 siRNA
20-abx905932
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UCP1 siRNA
20-abx938926
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UCP1 siRNA
20-abx938927
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pGEM-UCP1
PVT13596 2 ug
EUR 391
anti-UCP1
YF-PA24935 50 ul
EUR 334
Description: Mouse polyclonal to UCP1
UCP1 Antibody, HRP conjugated
1-CSB-PA025554LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
UCP1 Antibody, FITC conjugated
1-CSB-PA025554LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
UCP1 Antibody, Biotin conjugated
1-CSB-PA025554LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse)
4-PAF557Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1)
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat)
4-PAF557Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1)
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat)
4-PAF557Ra02
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1)
UCP1 Blocking Peptide
DF7720-BP 1mg
EUR 195
UCP1 cloning plasmid
CSB-CL025554HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 924
  • Sequence: ATGGGGGGCCTGACAGCCTCGGACGTACACCCGACCCTGGGGGTCCAGCTCTTCTCAGCTGGAATAGCGGCGTGCTTGGCGGACGTGATCACCTTCCCGCTGGACACGGCCAAAGTCCGGCTCCAGGTCCAAGGTGAATGCCCGACGTCCAGTGTTATTAGGTATAAAGGTGTCCT
  • Show more
Description: A cloning plasmid for the UCP1 gene.
Anti-UCP1 (4E5)
YF-MA16016 100 ug
EUR 363
Description: Mouse monoclonal to UCP1
Anti-UCP1 (4B7)
YF-MA16017 50 ug
EUR 363
Description: Mouse monoclonal to UCP1
Anti-UCP1 (4B7)
YF-MA20450 200 ul
EUR 363
Description: Mouse monoclonal to UCP1
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), APC
4-PAF557Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), Biotinylated
4-PAF557Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), Cy3
4-PAF557Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), FITC
4-PAF557Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), HRP
4-PAF557Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), PE
4-PAF557Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC
4-PAF557Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Biotinylated
4-PAF557Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Cy3
4-PAF557Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), FITC
4-PAF557Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), HRP
4-PAF557Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), PE
4-PAF557Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC
4-PAF557Ra02-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Biotinylated
4-PAF557Ra02-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Cy3
4-PAF557Ra02-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), FITC
4-PAF557Ra02-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), HRP
4-PAF557Ra02-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), PE
4-PAF557Ra02-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAF557Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC-Cy7
4-PAF557Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC-Cy7
4-PAF557Ra02-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx178804
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx178805
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx178806
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx210311
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx103784
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx103785
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx130224
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx175033
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Human UCP1 ELISA Kit
ELA-E2067h 96 Tests
EUR 824
Bovine UCP1 ELISA KIT
ELI-06629b 96 Tests
EUR 928
Mouse Ucp1 ELISA KIT
ELI-06630m 96 Tests
EUR 865
Canine UCP1 ELISA KIT
ELI-06633d 96 Tests
EUR 928
Human UCP1 ELISA KIT
ELI-06634h 96 Tests
EUR 824
UCP1 ELISA KIT|Human
EF006166 96 Tests
EUR 689
Mouse UCP1 shRNA Plasmid
20-abx973301
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat UCP1 shRNA Plasmid
20-abx984681
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human UCP1 shRNA Plasmid
20-abx955025
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UCP1 Recombinant Protein (Rat)
RP235742 100 ug Ask for price
pGEM-Ucp1-A8G-m
PVT14024 2 ug
EUR 391
UCP1 Recombinant Protein (Human)
RP044629 100 ug Ask for price
UCP1 Recombinant Protein (Mouse)
RP182945 100 ug Ask for price
Mouse UCP1 ELISA Kit
STJ150299 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of UCP-1 in Mouse serum, plasma and other biological fluids
Rabbit Mitochondrial brown fat uncoupling protein 1, UCP1 ELISA
ELI-06631Ra 96 Tests
EUR 928
Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) antiserum # 1
UCP11-S 100 ul
EUR 457
Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) antiserum # 2
UCP12-S 100 ul
EUR 457
Monoclonal UCP1 Antibody (monoclonal) (M01), Clone: 4E6
APR10646G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human UCP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4E6. This antibody is applicable in WB, E
Monoclonal UCP1 Antibody (monoclonal) (M03), Clone: 4B7
APR10647G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human UCP1 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4B7. This antibody is applicable in WB, E
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (Biotin)
20-abx272849
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (Biotin)
20-abx273298
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (FITC)
20-abx273880
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Ucp1 ORF Vector (Mouse) (pORF)
ORF060983 1.0 ug DNA
EUR 506
Ucp1 ORF Vector (Rat) (pORF)
ORF078582 1.0 ug DNA
EUR 506
m UCP1 inducible lentiviral particles
LVP905 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing mouse target: UCP1 (uncoupling protein 1, mitochondrial, proton carrier), [alternative names: AI385626; Slc25a7; Ucp]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_009463. It also contains a RFP-Blasticidin dual selection marker.
UCP1 ORF Vector (Human) (pORF)
ORF014877 1.0 ug DNA
EUR 95
ELISA kit for Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1)
KTE90123-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1)
KTE90123-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1)
KTE90123-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) IgG # 1, aff pure
UCP11-A 100 ul
EUR 482
Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) IgG #2, aff pure
UCP12-A 100 ug
EUR 482
Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
20-abx005463
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
20-abx004494
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
abx219236-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
abx239227-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
20-abx320419
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
20-abx322345
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
abx433424-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Ucp1 sgRNA CRISPR Lentivector set (Rat)
K7526001 3 x 1.0 ug
EUR 339
Ucp1 sgRNA CRISPR Lentivector set (Mouse)
K3728401 3 x 1.0 ug
EUR 339
UCP1 sgRNA CRISPR Lentivector set (Human)
K2581701 3 x 1.0 ug
EUR 339
Recombinant Uncoupling Protein 1, Mitochondrial (UCP1)
4-RPF557Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P12242
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.3kDa
  • Isoelectric Point: 7.7
Description: Recombinant Mouse Uncoupling Protein 1, Mitochondrial expressed in: E.coli
Recombinant Uncoupling Protein 1, Mitochondrial (UCP1)
4-RPF557Ra01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04633
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Uncoupling Protein 1, Mitochondrial expressed in: E.coli
Recombinant Uncoupling Protein 1, Mitochondrial (UCP1)
4-RPF557Ra02
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04633
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Uncoupling Protein 1, Mitochondrial expressed in: E.coli
Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody (Biotin)
20-abx105665
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

UCP1 Rabbit Polyclonal Antibody