PTMA Rabbit Polyclonal Antibody

PTMA Rabbit Polyclonal Antibody

Contact Us Below To Order :

PTMA Polyclonal Antibody

ES11817-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Prothymosin Alpha (PTMa) ELISA Kit

DLR-PTMa-Hu-48T 48T
EUR 517
  • Should the Human Prothymosin Alpha (PTMa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prothymosin Alpha (PTMa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit

DLR-PTMa-Hu-96T 96T
EUR 673
  • Should the Human Prothymosin Alpha (PTMa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prothymosin Alpha (PTMa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit

RDR-PTMa-Hu-48Tests 48 Tests
EUR 544

Human Prothymosin Alpha (PTMa) ELISA Kit

RDR-PTMa-Hu-96Tests 96 Tests
EUR 756

Human Prothymosin Alpha (PTMa) ELISA Kit

RD-PTMa-Hu-48Tests 48 Tests
EUR 521

Human Prothymosin Alpha (PTMa) ELISA Kit

RD-PTMa-Hu-96Tests 96 Tests
EUR 723

PTMA Rabbit pAb

A1956-100ul 100 ul
EUR 308

PTMA Rabbit pAb

A1956-200ul 200 ul
EUR 459

PTMA Rabbit pAb

A1956-20ul 20 ul
EUR 183

PTMA Rabbit pAb

A1956-50ul 50 ul
EUR 223

PTMA antibody

70R-19633 50 ul
EUR 435
Description: Rabbit polyclonal PTMA antibody

PTMA Antibody

37277-100ul 100ul
EUR 252

PTMA Antibody

1-CSB-PA721303
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PTMA Antibody

1-CSB-PA799716
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PTMA Antibody

1-CSB-PA272943
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PTMA Antibody

1-CSB-PA01524A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PTMA Antibody

1-CSB-PA019000GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Polyclonal PTMA Antibody (N-term)

APR03615G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTMA (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal PTMA Antibody (C-Term)

APG00574G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal PTMA Antibody (C-Terminus)

APG01175G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Terminus). This antibody is tested and proven to work in the following applications:

PTMA Polyclonal Antibody, Biotin Conjugated

A52461 100 µg
EUR 570.55
Description: Ask the seller for details

PTMA Polyclonal Antibody, FITC Conjugated

A52462 100 µg
EUR 570.55
Description: The best epigenetics products

PTMA Polyclonal Antibody, HRP Conjugated

A52463 100 µg
EUR 570.55
Description: kits suitable for this type of research

PTMA

E541-447 100ug
EUR 343

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human)

4-PAD221Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa)

PTMA Conjugated Antibody

C37277 100ul
EUR 397

Monoclonal PTMA Antibody

AMM01760G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human PTMA. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC, IP

Anti-PTMA antibody

STJ11100717 100 µl
EUR 277

Anti-PTMA antibody

STJ192975 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTMA

Anti-PTMA antibody

STJ71788 100 µg
EUR 359

Ptma/ Rat Ptma ELISA Kit

ELI-05265r 96 Tests
EUR 657

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC

4-PAD221Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Biotinylated

4-PAD221Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Biotin.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Cy3

4-PAD221Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Cy3.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), FITC

4-PAD221Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with FITC.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), HRP

4-PAD221Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with HRP.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), PE

4-PAD221Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with PE.

PTMA siRNA

20-abx904361
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTMA siRNA

20-abx930331
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTMA siRNA

20-abx930332
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTMA Antibody, HRP conjugated

1-CSB-PA01524B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PTMA Antibody, FITC conjugated

1-CSB-PA01524C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PTMA Antibody, Biotin conjugated

1-CSB-PA01524D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Prothymosin Alpha (PTMA) Antibody

abx026432-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody

abx026432-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody

20-abx110156
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody

20-abx121680
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMa) Antibody

20-abx128206
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prothymosin Alpha (PTMa) Antibody

20-abx174300
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Prothymosin Alpha (PTMA) Antibody

20-abx241156
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody

20-abx241411
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody

20-abx241412
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody

abx236808-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Prothymosin Alpha (PTMA) Antibody

abx431948-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC-Cy7

4-PAD221Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC-Cy7.

PTMA cloning plasmid

CSB-CL019000HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
  • Show more
Description: A cloning plasmid for the PTMA gene.

PTMA cloning plasmid

CSB-CL019000HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
  • Show more
Description: A cloning plasmid for the PTMA gene.

Human Prothymosin alpha (PTMA)

1-CSB-YP019000HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast

Human Prothymosin alpha (PTMA)

1-CSB-YP019000HUb0
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast

Rat Prothymosin alpha (Ptma)

1-CSB-YP019000RA
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Prothymosin alpha(Ptma) expressed in Yeast

PTMA protein (His tag)

80R-3024 50 ug
EUR 413
Description: Purified recombinant PTMA protein (His tag)

Human PTMA ELISA Kit

ELA-E1609h 96 Tests
EUR 824

PTMA ELISA KIT|Human

EF005969 96 Tests
EUR 689

Mouse PTMA shRNA Plasmid

20-abx972279
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PTMA shRNA Plasmid

20-abx985361
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Prothymosin Alpha (PTMA) Protein

20-abx262698
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Human PTMA shRNA Plasmid

20-abx953893
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Prothymosin Alpha (PTMa)

4-RPD221Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P06454
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.1kDa
  • Isoelectric Point: 3.7
Description: Recombinant Human Prothymosin Alpha expressed in: E.coli

Recombinant Prothymosin Alpha (PTMa)

4-RPD221Ra01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.2kDa
  • Isoelectric Point: 3.7
Description: Recombinant Rat Recombinant Prothymosin Alpha (PTMa) expressed in: E.coli

PTMA Recombinant Protein (Human)

RP025144 100 ug Ask for price

PTMA Recombinant Protein (Human)

RP025147 100 ug Ask for price

PTMA Recombinant Protein (Mouse)

RP165578 100 ug Ask for price

PTMA Recombinant Protein (Rat)

RP222875 100 ug Ask for price

Monoclonal PTMA Antibody (monoclonal) (M02), Clone: 1G8

AMM03967G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PTMA (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1G8. This antibody is applicable in WB, E

Human Prothymosin Alpha (PTMA) Protein

abx060044-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

Human Prothymosin Alpha (PTMa) Protein

20-abx166598
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Prothymosin Alpha (PTMa) Protein

20-abx654881
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ptma ORF Vector (Rat) (pORF)

ORF074293 1.0 ug DNA
EUR 506

PTMA ORF Vector (Human) (pORF)

ORF008382 1.0 ug DNA
EUR 95

PTMA ORF Vector (Human) (pORF)

ORF008383 1.0 ug DNA
EUR 95

Ptma ORF Vector (Mouse) (pORF)

ORF055194 1.0 ug DNA
EUR 506

Human Prothymosin Alpha (PTMa)ELISA kit

201-12-2264 96 tests
EUR 440
  • This Prothymosin Alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Prothymosin alpha (PTMa) ELISA Kit

20-abx152865
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Prothymosin alpha (PTMA) ELISA Kit

abx251157-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Mouse Ptma/ Prothymosin alpha ELISA Kit

E1227Mo 1 Kit
EUR 571

Human PTMA/ Prothymosin alpha ELISA Kit

E2090Hu 1 Kit
EUR 571

Human PTMA(Prothymosin alpha) ELISA Kit

EH1845 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P06454
  • Alias: PTMA/Prothymosin alpha/TMSA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Bovine Prothymosin alpha, PTMA ELISA KIT

ELI-05262b 96 Tests
EUR 928

Mouse Prothymosin alpha, Ptma ELISA KIT

ELI-05263m 96 Tests
EUR 865

Human Prothymosin alpha, PTMA ELISA KIT

ELI-05264h 96 Tests
EUR 824

Cow Prothymosin alpha (PTMA) ELISA Kit

abx517922-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Prothymosin alpha (PTMA) ELISA Kit

abx517923-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Prothymosin alpha (PTMA) ELISA Kit

abx517924-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Prothymosin alpha (PTMA) ELISA Kit

abx517925-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Prothymosin alpha (PTMa) CLIA Kit

20-abx494145
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Prothymosin Alpha(PTMa)ELISA kit

GA-E0811MS-48T 48T
EUR 336

Mouse Prothymosin Alpha(PTMa)ELISA kit

GA-E0811MS-96T 96T
EUR 534

Ptma sgRNA CRISPR Lentivector set (Rat)

K6832301 3 x 1.0 ug
EUR 339

Ptma sgRNA CRISPR Lentivector set (Mouse)

K4010001 3 x 1.0 ug
EUR 339

PTMA sgRNA CRISPR Lentivector set (Human)

K1752701 3 x 1.0 ug
EUR 339

PTMA Prothymosin Alpha Human Recombinant Protein

PROTP06454-1 Regular: 10ug
EUR 317
Description: PTMA Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 133 amino acids (1-110) and having a molecular mass of 14.5 kDa.;PTMA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Prothymosin Alpha(PTMa)ELISA Kit

QY-E01901 96T
EUR 361

Rat Prothymosin Alpha(PTMa)ELISA kit

QY-E10505 96T
EUR 361

Human Prothymosin Alpha (PTMa) ELISA Kit

SED221Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit

SED221Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit

SED221Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit

SED221Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit

4-SED221Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prothymosin Alpha elisa. Alternative names of the recognized antigen: TMSA
  • PTM-A
  • Pro-Thymosin A
  • Gene Sequence 28
  • Thymosin alpha-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prothymosin Alpha (PTMa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Prothymosin Alpha(PTMa)ELISA kit

QY-E21293 96T
EUR 361

ELISA kit for Human PTMa (Prothymosin Alpha)

ELK3885 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prothymosin Alpha (PTM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Prothymos
  • Show more
Description: A sandwich ELISA kit for detection of Prothymosin Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Prothymosin, alpha (PTMA)

KTE61059-48T 48T
EUR 354
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prothymosin, alpha (PTMA)

KTE61059-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prothymosin, alpha (PTMA)

KTE61059-96T 96T
EUR 572
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Ptma sgRNA CRISPR Lentivector (Rat) (Target 1)

K6832302 1.0 ug DNA
EUR 154

Ptma sgRNA CRISPR Lentivector (Rat) (Target 2)

K6832303 1.0 ug DNA
EUR 154

Ptma sgRNA CRISPR Lentivector (Rat) (Target 3)

K6832304 1.0 ug DNA
EUR 154

Ptma sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4010002 1.0 ug DNA
EUR 154

Ptma sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4010003 1.0 ug DNA
EUR 154

Ptma sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4010004 1.0 ug DNA
EUR 154

PTMA sgRNA CRISPR Lentivector (Human) (Target 1)

K1752702 1.0 ug DNA
EUR 154

PTMA sgRNA CRISPR Lentivector (Human) (Target 2)

K1752703 1.0 ug DNA
EUR 154

PTMA sgRNA CRISPR Lentivector (Human) (Target 3)

K1752704 1.0 ug DNA
EUR 154

ELISA kit for Canine Prothymosin, alpha (PTMA)

KTE20099-48T 48T
EUR 354
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Prothymosin, alpha (PTMA)

KTE20099-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Prothymosin, alpha (PTMA)

KTE20099-96T 96T
EUR 572
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PTMA Protein Vector (Rat) (pPB-C-His)

PV297170 500 ng
EUR 603

PTMA Protein Vector (Rat) (pPB-N-His)

PV297171 500 ng
EUR 603

PTMA Protein Vector (Rat) (pPM-C-HA)

PV297172 500 ng
EUR 603

PTMA Protein Vector (Rat) (pPM-C-His)

PV297173 500 ng
EUR 603

PTMA Protein Vector (Human) (pPB-C-His)

PV033525 500 ng
EUR 329

PTMA Protein Vector (Human) (pPB-N-His)

PV033526 500 ng
EUR 329

PTMA Protein Vector (Human) (pPM-C-HA)

PV033527 500 ng
EUR 329

PTMA Protein Vector (Human) (pPM-C-His)

PV033528 500 ng
EUR 329

PTMA Protein Vector (Human) (pPB-C-His)

PV033529 500 ng
EUR 329

PTMA Protein Vector (Human) (pPB-N-His)

PV033530 500 ng
EUR 329

PTMA Protein Vector (Human) (pPM-C-HA)

PV033531 500 ng
EUR 329

PTMA Protein Vector (Human) (pPM-C-His)

PV033532 500 ng
EUR 329

PTMA Protein Vector (Mouse) (pPB-C-His)

PV220774 500 ng
EUR 603

PTMA Protein Vector (Mouse) (pPB-N-His)

PV220775 500 ng
EUR 603

PTMA Protein Vector (Mouse) (pPM-C-HA)

PV220776 500 ng
EUR 603

PTMA Protein Vector (Mouse) (pPM-C-His)

PV220777 500 ng
EUR 603

Recombinant Human PTMA Protein, His, E.coli-10ug

QP13206-10ug 10ug
EUR 201

Recombinant Human PTMA Protein, His, E.coli-1mg

QP13206-1mg 1mg
EUR 5251

Recombinant Human PTMA Protein, His, E.coli-2ug

QP13206-2ug 2ug
EUR 155

Recombinant Rat PTMA Protein, His, Yeast-100ug

QP9354-ye-100ug 100ug
EUR 571

Recombinant Rat PTMA Protein, His, Yeast-10ug

QP9354-ye-10ug 10ug
EUR 272

Recombinant Rat PTMA Protein, His, Yeast-1mg

QP9354-ye-1mg 1mg
EUR 2303

Recombinant Rat PTMA Protein, His, Yeast-200ug

QP9354-ye-200ug 200ug
EUR 898

Recombinant Rat PTMA Protein, His, Yeast-500ug

QP9354-ye-500ug 500ug
EUR 1505

Recombinant Rat PTMA Protein, His, Yeast-50ug

QP9354-ye-50ug 50ug
EUR 354

Ptma 3'UTR Luciferase Stable Cell Line

TU117256 1.0 ml Ask for price

Ptma 3'UTR GFP Stable Cell Line

TU167256 1.0 ml Ask for price

Ptma 3'UTR Luciferase Stable Cell Line

TU217049 1.0 ml Ask for price

Ptma 3'UTR GFP Stable Cell Line

TU267049 1.0 ml Ask for price

PTMA 3'UTR GFP Stable Cell Line

TU069172 1.0 ml
EUR 1394

PTMA 3'UTR Luciferase Stable Cell Line

TU019172 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

PTMA Rabbit Polyclonal Antibody