PTMA Rabbit Polyclonal Antibody

PTMA Rabbit Polyclonal Antibody

Contact Us Below To Order :

    PTMA Polyclonal Antibody

    ES11817-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Human Prothymosin Alpha (PTMa) ELISA Kit

    DLR-PTMa-Hu-48T 48T
    EUR 517
    • Should the Human Prothymosin Alpha (PTMa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Prothymosin Alpha (PTMa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

    Human Prothymosin Alpha (PTMa) ELISA Kit

    DLR-PTMa-Hu-96T 96T
    EUR 673
    • Should the Human Prothymosin Alpha (PTMa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Prothymosin Alpha (PTMa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

    Human Prothymosin Alpha (PTMa) ELISA Kit

    RDR-PTMa-Hu-48Tests 48 Tests
    EUR 544

    Human Prothymosin Alpha (PTMa) ELISA Kit

    RDR-PTMa-Hu-96Tests 96 Tests
    EUR 756

    Human Prothymosin Alpha (PTMa) ELISA Kit

    RD-PTMa-Hu-48Tests 48 Tests
    EUR 521

    Human Prothymosin Alpha (PTMa) ELISA Kit

    RD-PTMa-Hu-96Tests 96 Tests
    EUR 723

    PTMA Rabbit pAb

    A1956-100ul 100 ul
    EUR 308

    PTMA Rabbit pAb

    A1956-200ul 200 ul
    EUR 459

    PTMA Rabbit pAb

    A1956-20ul 20 ul
    EUR 183

    PTMA Rabbit pAb

    A1956-50ul 50 ul
    EUR 223

    PTMA antibody

    70R-19633 50 ul
    EUR 435
    Description: Rabbit polyclonal PTMA antibody

    PTMA Antibody

    37277-100ul 100ul
    EUR 252

    PTMA Antibody

    1-CSB-PA721303
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

    PTMA Antibody

    1-CSB-PA799716
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

    PTMA Antibody

    1-CSB-PA272943
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

    PTMA Antibody

    1-CSB-PA01524A0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    PTMA Antibody

    1-CSB-PA019000GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

    Polyclonal PTMA Antibody (N-term)

    APR03615G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTMA (N-term). This antibody is tested and proven to work in the following applications:

    Polyclonal PTMA Antibody (C-Term)

    APG00574G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Term). This antibody is tested and proven to work in the following applications:

    Polyclonal PTMA Antibody (C-Terminus)

    APG01175G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Terminus). This antibody is tested and proven to work in the following applications:

    PTMA Polyclonal Antibody, Biotin Conjugated

    A52461 100 µg
    EUR 570.55
    Description: Ask the seller for details

    PTMA Polyclonal Antibody, FITC Conjugated

    A52462 100 µg
    EUR 570.55
    Description: The best epigenetics products

    PTMA Polyclonal Antibody, HRP Conjugated

    A52463 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    PTMA

    E541-447 100ug
    EUR 343

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human)

    4-PAD221Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa)

    PTMA Conjugated Antibody

    C37277 100ul
    EUR 397

    Monoclonal PTMA Antibody

    AMM01760G 0.05mg
    EUR 484
    Description: A Monoclonal antibody against Human PTMA. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC, IP

    Anti-PTMA antibody

    STJ11100717 100 µl
    EUR 277

    Anti-PTMA antibody

    STJ192975 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to PTMA

    Anti-PTMA antibody

    STJ71788 100 µg
    EUR 359

    Ptma/ Rat Ptma ELISA Kit

    ELI-05265r 96 Tests
    EUR 657

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC

    4-PAD221Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC.

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Biotinylated

    4-PAD221Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Biotin.

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Cy3

    4-PAD221Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Cy3.

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), FITC

    4-PAD221Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with FITC.

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), HRP

    4-PAD221Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with HRP.

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), PE

    4-PAD221Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with PE.

    PTMA siRNA

    20-abx904361
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PTMA siRNA

    20-abx930331
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PTMA siRNA

    20-abx930332
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PTMA Antibody, HRP conjugated

    1-CSB-PA01524B0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    PTMA Antibody, FITC conjugated

    1-CSB-PA01524C0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    PTMA Antibody, Biotin conjugated

    1-CSB-PA01524D0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Prothymosin Alpha (PTMA) Antibody

    abx026432-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMA) Antibody

    abx026432-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMA) Antibody

    20-abx110156
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMA) Antibody

    20-abx121680
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMa) Antibody

    20-abx128206
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Prothymosin Alpha (PTMa) Antibody

    20-abx174300
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Prothymosin Alpha (PTMA) Antibody

    20-abx241156
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMA) Antibody

    20-abx241411
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMA) Antibody

    20-abx241412
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMA) Antibody

    abx236808-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    Prothymosin Alpha (PTMA) Antibody

    abx431948-200ul 200 ul
    EUR 286
    • Shipped within 1-3 working days.

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC-Cy7

    4-PAD221Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC-Cy7.

    PTMA cloning plasmid

    CSB-CL019000HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 333
    • Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
    • Show more
    Description: A cloning plasmid for the PTMA gene.

    PTMA cloning plasmid

    CSB-CL019000HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 333
    • Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
    • Show more
    Description: A cloning plasmid for the PTMA gene.

    Human Prothymosin alpha (PTMA)

    1-CSB-YP019000HU
    • EUR 430.00
    • EUR 234.00
    • EUR 1508.00
    • EUR 642.00
    • EUR 1009.00
    • EUR 291.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 14.2 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast

    Human Prothymosin alpha (PTMA)

    1-CSB-YP019000HUb0
    • EUR 430.00
    • EUR 234.00
    • EUR 1508.00
    • EUR 642.00
    • EUR 1009.00
    • EUR 291.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 14.7 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast

    Rat Prothymosin alpha (Ptma)

    1-CSB-YP019000RA
    • EUR 504.00
    • EUR 265.00
    • EUR 1832.00
    • EUR 763.00
    • EUR 1216.00
    • EUR 334.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 14.3 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Rat Prothymosin alpha(Ptma) expressed in Yeast

    PTMA protein (His tag)

    80R-3024 50 ug
    EUR 413
    Description: Purified recombinant PTMA protein (His tag)

    Human PTMA ELISA Kit

    ELA-E1609h 96 Tests
    EUR 824

    PTMA ELISA KIT|Human

    EF005969 96 Tests
    EUR 689

    Mouse PTMA shRNA Plasmid

    20-abx972279
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat PTMA shRNA Plasmid

    20-abx985361
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Prothymosin Alpha (PTMA) Protein

    20-abx262698
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.

    Human PTMA shRNA Plasmid

    20-abx953893
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Recombinant Prothymosin Alpha (PTMa)

    4-RPD221Hu01
    • EUR 467.36
    • EUR 228.00
    • EUR 1477.60
    • EUR 559.20
    • EUR 1018.40
    • EUR 376.00
    • EUR 3544.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P06454
    • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 42.1kDa
    • Isoelectric Point: 3.7
    Description: Recombinant Human Prothymosin Alpha expressed in: E.coli

    Recombinant Prothymosin Alpha (PTMa)

    4-RPD221Ra01
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Inquire
    • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 42.2kDa
    • Isoelectric Point: 3.7
    Description: Recombinant Rat Recombinant Prothymosin Alpha (PTMa) expressed in: E.coli

    PTMA Recombinant Protein (Human)

    RP025144 100 ug Ask for price

    PTMA Recombinant Protein (Human)

    RP025147 100 ug Ask for price

    PTMA Recombinant Protein (Mouse)

    RP165578 100 ug Ask for price

    PTMA Recombinant Protein (Rat)

    RP222875 100 ug Ask for price

    Monoclonal PTMA Antibody (monoclonal) (M02), Clone: 1G8

    AMM03967G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human PTMA (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1G8. This antibody is applicable in WB, E

    Human Prothymosin Alpha (PTMA) Protein

    abx060044-100ug 100 ug
    EUR 328
    • Shipped within 5-10 working days.

    Human Prothymosin Alpha (PTMa) Protein

    20-abx166598
    • EUR 648.00
    • EUR 272.00
    • EUR 1998.00
    • EUR 773.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Rat Prothymosin Alpha (PTMa) Protein

    20-abx654881
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Ptma ORF Vector (Rat) (pORF)

    ORF074293 1.0 ug DNA
    EUR 506

    PTMA ORF Vector (Human) (pORF)

    ORF008382 1.0 ug DNA
    EUR 95

    PTMA ORF Vector (Human) (pORF)

    ORF008383 1.0 ug DNA
    EUR 95

    Ptma ORF Vector (Mouse) (pORF)

    ORF055194 1.0 ug DNA
    EUR 506

    PTMA ELISA Kit (Human) (OKCD08419)

    OKCD08419 96 Wells
    EUR 975
    Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

    PTMA ELISA Kit (Human) (OKEH01154)

    OKEH01154 96 Wells
    EUR 662
    Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.039 ng/mL

    PTMA ELISA Kit (Rat) (OKEH06132)

    OKEH06132 96 Wells
    EUR 662
    Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.166 ng/mL

    PTMA ELISA Kit (Mouse) (OKEH04264)

    OKEH04264 96 Wells
    EUR 662
    Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.164 ng/mL

    Human Prothymosin Alpha (PTMa)ELISA kit

    201-12-2264 96 tests
    EUR 440
    • This Prothymosin Alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Prothymosin alpha (PTMa) ELISA Kit

    20-abx152865
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Prothymosin alpha (PTMA) ELISA Kit

    abx251157-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.

    Mouse Ptma/ Prothymosin alpha ELISA Kit

    E1227Mo 1 Kit
    EUR 571

    Human PTMA/ Prothymosin alpha ELISA Kit

    E2090Hu 1 Kit
    EUR 571

    Human PTMA(Prothymosin alpha) ELISA Kit

    EH1845 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P06454
    • Alias: PTMA/Prothymosin alpha/TMSA
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Bovine Prothymosin alpha, PTMA ELISA KIT

    ELI-05262b 96 Tests
    EUR 928

    Mouse Prothymosin alpha, Ptma ELISA KIT

    ELI-05263m 96 Tests
    EUR 865

    Human Prothymosin alpha, PTMA ELISA KIT

    ELI-05264h 96 Tests
    EUR 824

    Cow Prothymosin alpha (PTMA) ELISA Kit

    abx517922-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Prothymosin alpha (PTMA) ELISA Kit

    abx517923-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Mouse Prothymosin alpha (PTMA) ELISA Kit

    abx517924-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Rat Prothymosin alpha (PTMA) ELISA Kit

    abx517925-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Prothymosin alpha (PTMa) CLIA Kit

    20-abx494145
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Mouse Prothymosin Alpha(PTMa)ELISA kit

    GA-E0811MS-48T 48T
    EUR 336

    Mouse Prothymosin Alpha(PTMa)ELISA kit

    GA-E0811MS-96T 96T
    EUR 534

    Ptma sgRNA CRISPR Lentivector set (Rat)

    K6832301 3 x 1.0 ug
    EUR 339

    Ptma sgRNA CRISPR Lentivector set (Mouse)

    K4010001 3 x 1.0 ug
    EUR 339

    PTMA sgRNA CRISPR Lentivector set (Human)

    K1752701 3 x 1.0 ug
    EUR 339

    PTMA Prothymosin Alpha Human Recombinant Protein

    PROTP06454-1 Regular: 10ug
    EUR 317
    Description: PTMA Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 133 amino acids (1-110) and having a molecular mass of 14.5 kDa.;PTMA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

    Human Prothymosin Alpha(PTMa)ELISA Kit

    QY-E01901 96T
    EUR 361

    Rat Prothymosin Alpha(PTMa)ELISA kit

    QY-E10505 96T
    EUR 361

    Human Prothymosin Alpha (PTMa) ELISA Kit

    SED221Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

    Human Prothymosin Alpha (PTMa) ELISA Kit

    SED221Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

    Human Prothymosin Alpha (PTMa) ELISA Kit

    SED221Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

    Human Prothymosin Alpha (PTMa) ELISA Kit

    SED221Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

    Human Prothymosin Alpha (PTMa) ELISA Kit

    4-SED221Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Prothymosin Alpha elisa. Alternative names of the recognized antigen: TMSA
    • PTM-A
    • Pro-Thymosin A
    • Gene Sequence 28
    • Thymosin alpha-1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prothymosin Alpha (PTMa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Mouse Prothymosin Alpha(PTMa)ELISA kit

    QY-E21293 96T
    EUR 361

    ELISA kit for Human PTMa (Prothymosin Alpha)

    ELK3885 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prothymosin Alpha (PTM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Prothymos
    • Show more
    Description: A sandwich ELISA kit for detection of Prothymosin Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Prothymosin, alpha (PTMA)

    KTE61059-48T 48T
    EUR 354
    • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Prothymosin, alpha (PTMA)

    KTE61059-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Prothymosin, alpha (PTMA)

    KTE61059-96T 96T
    EUR 572
    • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Ptma sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6832302 1.0 ug DNA
    EUR 154

    Ptma sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6832303 1.0 ug DNA
    EUR 154

    Ptma sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6832304 1.0 ug DNA
    EUR 154

    Ptma sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4010002 1.0 ug DNA
    EUR 154

    Ptma sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4010003 1.0 ug DNA
    EUR 154

    Ptma sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4010004 1.0 ug DNA
    EUR 154

    PTMA sgRNA CRISPR Lentivector (Human) (Target 1)

    K1752702 1.0 ug DNA
    EUR 154

    PTMA sgRNA CRISPR Lentivector (Human) (Target 2)

    K1752703 1.0 ug DNA
    EUR 154

    PTMA sgRNA CRISPR Lentivector (Human) (Target 3)

    K1752704 1.0 ug DNA
    EUR 154

    ELISA kit for Canine Prothymosin, alpha (PTMA)

    KTE20099-48T 48T
    EUR 354
    • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Canine Prothymosin, alpha (PTMA)

    KTE20099-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Canine Prothymosin, alpha (PTMA)

    KTE20099-96T 96T
    EUR 572
    • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    PTMA Protein Vector (Rat) (pPB-C-His)

    PV297170 500 ng
    EUR 603

    PTMA Protein Vector (Rat) (pPB-N-His)

    PV297171 500 ng
    EUR 603

    PTMA Protein Vector (Rat) (pPM-C-HA)

    PV297172 500 ng
    EUR 603

    PTMA Protein Vector (Rat) (pPM-C-His)

    PV297173 500 ng
    EUR 603

    PTMA Protein Vector (Human) (pPB-C-His)

    PV033525 500 ng
    EUR 329

    PTMA Protein Vector (Human) (pPB-N-His)

    PV033526 500 ng
    EUR 329

    PTMA Protein Vector (Human) (pPM-C-HA)

    PV033527 500 ng
    EUR 329

    PTMA Protein Vector (Human) (pPM-C-His)

    PV033528 500 ng
    EUR 329

    PTMA Protein Vector (Human) (pPB-C-His)

    PV033529 500 ng
    EUR 329

    PTMA Protein Vector (Human) (pPB-N-His)

    PV033530 500 ng
    EUR 329

    PTMA Protein Vector (Human) (pPM-C-HA)

    PV033531 500 ng
    EUR 329

    PTMA Protein Vector (Human) (pPM-C-His)

    PV033532 500 ng
    EUR 329

    PTMA Protein Vector (Mouse) (pPB-C-His)

    PV220774 500 ng
    EUR 603

    PTMA Protein Vector (Mouse) (pPB-N-His)

    PV220775 500 ng
    EUR 603

    PTMA Protein Vector (Mouse) (pPM-C-HA)

    PV220776 500 ng
    EUR 603

    PTMA Protein Vector (Mouse) (pPM-C-His)

    PV220777 500 ng
    EUR 603

    Recombinant Human PTMA Protein, His, E.coli-10ug

    QP13206-10ug 10ug
    EUR 201

    Recombinant Human PTMA Protein, His, E.coli-1mg

    QP13206-1mg 1mg
    EUR 5251

    Recombinant Human PTMA Protein, His, E.coli-2ug

    QP13206-2ug 2ug
    EUR 155

    Recombinant Rat PTMA Protein, His, Yeast-100ug

    QP9354-ye-100ug 100ug
    EUR 571

    Recombinant Rat PTMA Protein, His, Yeast-10ug

    QP9354-ye-10ug 10ug
    EUR 272

    Recombinant Rat PTMA Protein, His, Yeast-1mg

    QP9354-ye-1mg 1mg
    EUR 2303

    Recombinant Rat PTMA Protein, His, Yeast-200ug

    QP9354-ye-200ug 200ug
    EUR 898

    Recombinant Rat PTMA Protein, His, Yeast-500ug

    QP9354-ye-500ug 500ug
    EUR 1505

    Recombinant Rat PTMA Protein, His, Yeast-50ug

    QP9354-ye-50ug 50ug
    EUR 354

    Ptma 3'UTR Luciferase Stable Cell Line

    TU117256 1.0 ml Ask for price

    Ptma 3'UTR GFP Stable Cell Line

    TU167256 1.0 ml Ask for price

    Ptma 3'UTR Luciferase Stable Cell Line

    TU217049 1.0 ml Ask for price

    Ptma 3'UTR GFP Stable Cell Line

    TU267049 1.0 ml Ask for price

    PTMA 3'UTR GFP Stable Cell Line

    TU069172 1.0 ml
    EUR 1394

    PTMA 3'UTR Luciferase Stable Cell Line

    TU019172 1.0 ml
    EUR 1394

    GAPDH Rabbit Polyclonal Antibody

    37985-100ul 100ul
    EUR 252

    GAPDH Rabbit Polyclonal Antibody

    37985-50ul 50ul
    EUR 187

    EFHD1 Rabbit Polyclonal Antibody

    38001-100ul 100ul
    EUR 252

    EFHD1 Rabbit Polyclonal Antibody

    38001-50ul 50ul
    EUR 187

    Alliinase Rabbit Polyclonal Antibody

    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody

    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody

    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody

    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody

    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody

    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody

    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody

    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody

    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody

    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody

    38086-100ul 100ul
    EUR 252

    AmCyan Rabbit Polyclonal Antibody

    38086-50ul 50ul
    EUR 187

    EBFP Rabbit Polyclonal Antibody

    38087-100ul 100ul
    EUR 252

    EBFP Rabbit Polyclonal Antibody

    38087-50ul 50ul
    EUR 187

    Vimentin Rabbit Polyclonal Antibody

    38104-100ul 100ul
    EUR 252

    Vimentin Rabbit Polyclonal Antibody

    38104-50ul 50ul
    EUR 187

    LDHD Rabbit Polyclonal Antibody

    38105-100ul 100ul
    EUR 252

    LDHD Rabbit Polyclonal Antibody

    38105-50ul 50ul
    EUR 187

    GAPDH Rabbit Polyclonal Antibody

    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Rabbit Hemoglobin Polyclonal Antibody

    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    VEGF Rabbit Polyclonal Antibody

    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    CD10 Rabbit Polyclonal Antibody

    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    PTMA Rabbit Polyclonal Antibody