PMVK Rabbit Polyclonal Antibody

PMVK Rabbit Polyclonal Antibody

Contact Us Below To Order :

    PMVK Polyclonal Antibody

    ABP59958-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human PMVK protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PMVK from Human. This PMVK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PMVK protein

    PMVK Polyclonal Antibody

    ABP59958-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human PMVK protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PMVK from Human. This PMVK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PMVK protein

    PMVK Polyclonal Antibody

    28386-100ul 100ul
    EUR 252

    PMVK Polyclonal Antibody

    28386-50ul 50ul
    EUR 187

    PMVK Polyclonal Antibody

    28387-100ul 100ul
    EUR 252

    PMVK Polyclonal Antibody

    28387-50ul 50ul
    EUR 187

    PMVK Rabbit pAb

    A13865-100ul 100 ul
    EUR 308

    PMVK Rabbit pAb

    A13865-200ul 200 ul
    EUR 459

    PMVK Rabbit pAb

    A13865-20ul 20 ul
    EUR 183

    PMVK Rabbit pAb

    A13865-50ul 50 ul
    EUR 223

    PMVK Rabbit pAb

    A13866-100ul 100 ul
    EUR 308

    PMVK Rabbit pAb

    A13866-200ul 200 ul
    EUR 459

    PMVK Rabbit pAb

    A13866-20ul 20 ul
    EUR 183

    PMVK Rabbit pAb

    A13866-50ul 50 ul
    EUR 223

    PMVK Polyclonal Conjugated Antibody

    C28386 100ul
    EUR 397

    PMVK Polyclonal Conjugated Antibody

    C28387 100ul
    EUR 397

    PMVK Antibody

    39840-100ul 100ul
    EUR 390

    PMVK antibody

    10R-5327 100 ul
    EUR 691
    Description: Mouse monoclonal PMVK antibody

    PMVK antibody

    70R-19373 50 ul
    EUR 435
    Description: Rabbit polyclonal PMVK antibody

    PMVK antibody

    70R-13751 100 ug
    EUR 322
    Description: Affinity purified Rabbit polyclonal PMVK antibody

    PMVK Antibody

    1-CSB-PA018258GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against PMVK. Recognizes PMVK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    anti- PMVK antibody

    FNab06580 100µg
    EUR 548.75
    • Immunogen: phosphomevalonate kinase
    • Uniprot ID: Q15126
    • Gene ID: 10654
    • Research Area: Metabolism
    Description: Antibody raised against PMVK

    Human PMVK Antibody

    33163-05111 150 ug
    EUR 261

    Anti-PMVK antibody

    PAab06580 100 ug
    EUR 386

    Anti-PMVK Antibody

    PA1067 100ug/vial
    EUR 334

    Anti-PMVK antibody

    STJ192973 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to PMVK

    Anti-PMVK antibody

    STJ115804 100 µl
    EUR 277
    Description: This gene encodes a peroxisomal enzyme that is a member of the galactokinase, homoserine kinase, mevalonate kinase, and phosphomevalonate kinase (GHMP) family of ATP-dependent enzymes. The encoded protein catalyzes the conversion of mevalonate 5-phosphate to mevalonate 5-diphosphate, which is the fifth step in the mevalonate pathway of isoprenoid biosynthesis. Mutations in this gene are linked to certain types of porokeratosis including disseminated superficial porokeratosis. Alternative splicing results in multiple transcript variants.

    Anti-PMVK antibody

    STJ115805 100 µl
    EUR 277
    Description: This gene encodes a peroxisomal enzyme that is a member of the galactokinase, homoserine kinase, mevalonate kinase, and phosphomevalonate kinase (GHMP) family of ATP-dependent enzymes. The encoded protein catalyzes the conversion of mevalonate 5-phosphate to mevalonate 5-diphosphate, which is the fifth step in the mevalonate pathway of isoprenoid biosynthesis. Mutations in this gene are linked to certain types of porokeratosis including disseminated superficial porokeratosis. Alternative splicing results in multiple transcript variants.

    PMVK siRNA

    20-abx929055
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PMVK siRNA

    20-abx929056
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    anti-PMVK

    YF-PA17142 50 ul
    EUR 363
    Description: Mouse polyclonal to PMVK

    anti-PMVK

    YF-PA17143 50 ug
    EUR 363
    Description: Mouse polyclonal to PMVK

    anti-PMVK

    YF-PA17144 100 ul
    EUR 403
    Description: Rabbit polyclonal to PMVK

    anti-PMVK

    YF-PA17145 100 ug
    EUR 403
    Description: Rabbit polyclonal to PMVK

    Rabbit Phosphomevalonate kinase(PMVK) ELISA kit

    E04P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Phosphomevalonate kinase(PMVK) ELISA kit

    E04P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Phosphomevalonate kinase(PMVK) ELISA kit

    E04P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Phosphomevalonate Kinase (PMVK) Antibody

    abx036227-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Phosphomevalonate Kinase (PMVK) Antibody

    abx236580-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    PMVK cloning plasmid

    CSB-CL018258HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 579
    • Sequence: atggccccgctgggaggcgccccgcggctggtactgctgttcagcggcaagaggaaatccgggaaggacttcgtgaccgaggcgctgcagagcagacttggagctgatgtctgtgctgtcctccggctctctggtccactcaaggaacagtatgctcaggagcatggcttgaactt
    • Show more
    Description: A cloning plasmid for the PMVK gene.

    Anti-PMVK (2B8)

    YF-MA17421 100 ug
    EUR 363
    Description: Mouse monoclonal to PMVK

    Anti-PMVK (2B8)

    YF-MA17422 200 ul
    EUR 363
    Description: Mouse monoclonal to PMVK

    Human PMVK Antibody (Biotin Conjugate)

    33163-05121 150 ug
    EUR 369

    Human PMVK AssayLite Antibody (FITC Conjugate)

    33163-05141 150 ug
    EUR 428

    Human PMVK AssayLite Antibody (RPE Conjugate)

    33163-05151 150 ug
    EUR 428

    Human PMVK AssayLite Antibody (APC Conjugate)

    33163-05161 150 ug
    EUR 428

    Human PMVK AssayLite Antibody (PerCP Conjugate)

    33163-05171 150 ug
    EUR 471

    Mouse PMVK shRNA Plasmid

    20-abx976675
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    PMVK ELISA KIT|Human

    EF001891 96 Tests
    EUR 689

    Human PMVK shRNA Plasmid

    20-abx957262
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    PMVK protein (His tag)

    80R-1495 100 ug
    EUR 305
    Description: Purified recombinant Human PMVK protein

    PMVK Recombinant Protein (Human)

    RP023917 100 ug Ask for price

    PMVK Recombinant Protein (Rat)

    RP221147 100 ug Ask for price

    PMVK Recombinant Protein (Mouse)

    RP163097 100 ug Ask for price

    PMVK Recombinant Protein (Mouse)

    RP163100 100 ug Ask for price

    PMVK ORF Vector (Human) (pORF)

    ORF007973 1.0 ug DNA
    EUR 95

    Pmvk ORF Vector (Rat) (pORF)

    ORF073717 1.0 ug DNA
    EUR 506

    Pmvk ORF Vector (Mouse) (pORF)

    ORF054367 1.0 ug DNA
    EUR 506

    Pmvk ORF Vector (Mouse) (pORF)

    ORF054368 1.0 ug DNA
    EUR 506

    Rat Phosphomevalonate kinase(PMVK) ELISA kit

    E02P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Phosphomevalonate kinase(PMVK) ELISA kit

    E02P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Phosphomevalonate kinase(PMVK) ELISA kit

    E02P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Phosphomevalonate kinase(PMVK) ELISA kit

    E03P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Phosphomevalonate kinase(PMVK) ELISA kit

    E03P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Phosphomevalonate kinase(PMVK) ELISA kit

    E03P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phosphomevalonate kinase(PMVK) ELISA kit

    E01P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phosphomevalonate kinase(PMVK) ELISA kit

    E01P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phosphomevalonate kinase(PMVK) ELISA kit

    E01P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Phosphomevalonate kinase(PMVK) ELISA kit

    E06P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Phosphomevalonate kinase(PMVK) ELISA kit

    E06P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Phosphomevalonate kinase(PMVK) ELISA kit

    E06P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Phosphomevalonate kinase(PMVK) ELISA kit

    E07P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Phosphomevalonate kinase(PMVK) ELISA kit

    E07P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Phosphomevalonate kinase(PMVK) ELISA kit

    E07P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Phosphomevalonate kinase(PMVK) ELISA kit

    E08P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Phosphomevalonate kinase(PMVK) ELISA kit

    E08P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Phosphomevalonate kinase(PMVK) ELISA kit

    E08P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Phosphomevalonate kinase(PMVK) ELISA kit

    E09P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Phosphomevalonate kinase(PMVK) ELISA kit

    E09P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Phosphomevalonate kinase(PMVK) ELISA kit

    E09P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Bovine Phosphomevalonate kinase, PMVK ELISA KIT

    ELI-19695b 96 Tests
    EUR 928

    Human Phosphomevalonate kinase, PMVK ELISA KIT

    ELI-19696h 96 Tests
    EUR 824

    Mouse Phosphomevalonate kinase, Pmvk ELISA KIT

    ELI-21710m 96 Tests
    EUR 865

    Porcine Phosphomevalonate kinase, PMVK ELISA KIT

    ELI-45542p 96 Tests
    EUR 928

    Human Phosphomevalonate kinase (PMVK) ELISA Kit

    abx382319-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Phosphomevalonate kinase (PMVK) ELISA Kit

    abx390228-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    PMVK sgRNA CRISPR Lentivector set (Human)

    K1675701 3 x 1.0 ug
    EUR 339

    Pmvk sgRNA CRISPR Lentivector set (Mouse)

    K3487601 3 x 1.0 ug
    EUR 339

    Pmvk sgRNA CRISPR Lentivector set (Rat)

    K7264101 3 x 1.0 ug
    EUR 339

    PMVK Phosphomevalonate Kinase Human Recombinant Protein

    PROTQ15126 Regular: 20ug
    EUR 317
    Description: PMVK Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 212 amino acids (1-192 a.a.) and having a molecular mass of 24.1kDa. The PMVK is purified by proprietary chromatographic techniques.

    Recombinant Human Phosphomevalonate Kinase/PMVK (N-6His)

    C248-10ug 10ug
    EUR 202
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 7.5.

    Recombinant Human Phosphomevalonate Kinase/PMVK (N-6His)

    C248-1mg 1mg
    EUR 2283
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 7.5.

    Recombinant Human Phosphomevalonate Kinase/PMVK (N-6His)

    C248-500ug 500ug
    EUR 1613
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 7.5.

    Recombinant Human Phosphomevalonate Kinase/PMVK (N-6His)

    C248-50ug 50ug
    EUR 496
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 7.5.

    Guinea pig Phosphomevalonate kinase(PMVK) ELISA kit

    E05P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Phosphomevalonate kinase(PMVK) ELISA kit

    E05P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Phosphomevalonate kinase(PMVK) ELISA kit

    E05P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    PMVK sgRNA CRISPR Lentivector (Human) (Target 1)

    K1675702 1.0 ug DNA
    EUR 154

    PMVK sgRNA CRISPR Lentivector (Human) (Target 2)

    K1675703 1.0 ug DNA
    EUR 154

    PMVK sgRNA CRISPR Lentivector (Human) (Target 3)

    K1675704 1.0 ug DNA
    EUR 154

    Pmvk sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3487602 1.0 ug DNA
    EUR 154

    Pmvk sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3487603 1.0 ug DNA
    EUR 154

    Pmvk sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3487604 1.0 ug DNA
    EUR 154

    Pmvk sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7264102 1.0 ug DNA
    EUR 154

    Pmvk sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7264103 1.0 ug DNA
    EUR 154

    Pmvk sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7264104 1.0 ug DNA
    EUR 154

    ELISA kit for Bovine Phosphomevalonate kinase (PMVK)

    KTE10200-48T 48T
    EUR 354
    • PMVK (EC 2.7.4.2) is a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate as the fifth reaction of the cholesterol biosynthetic pathway. The deduced 192-amino acid PMVK protein has a calculated mo
    • Show more
    Description: Quantitative sandwich ELISA for measuring Bovine Phosphomevalonate kinase (PMVK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Bovine Phosphomevalonate kinase (PMVK)

    KTE10200-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • PMVK (EC 2.7.4.2) is a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate as the fifth reaction of the cholesterol biosynthetic pathway. The deduced 192-amino acid PMVK protein has a calculated mo
    • Show more
    Description: Quantitative sandwich ELISA for measuring Bovine Phosphomevalonate kinase (PMVK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Bovine Phosphomevalonate kinase (PMVK)

    KTE10200-96T 96T
    EUR 572
    • PMVK (EC 2.7.4.2) is a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate as the fifth reaction of the cholesterol biosynthetic pathway. The deduced 192-amino acid PMVK protein has a calculated mo
    • Show more
    Description: Quantitative sandwich ELISA for measuring Bovine Phosphomevalonate kinase (PMVK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Recombinant Human PMVK Protein, His, E.coli-1mg

    QP13082-1mg 1mg
    EUR 2757

    Recombinant Human PMVK Protein, His, E.coli-20ug

    QP13082-20ug 20ug
    EUR 201

    Recombinant Human PMVK Protein, His, E.coli-5ug

    QP13082-5ug 5ug
    EUR 155

    PMVK Protein Vector (Human) (pPB-C-His)

    PV031889 500 ng
    EUR 329

    PMVK Protein Vector (Human) (pPB-N-His)

    PV031890 500 ng
    EUR 329

    PMVK Protein Vector (Human) (pPM-C-HA)

    PV031891 500 ng
    EUR 329

    PMVK Protein Vector (Human) (pPM-C-His)

    PV031892 500 ng
    EUR 329

    PMVK Protein Vector (Mouse) (pPB-C-His)

    PV217466 500 ng
    EUR 603

    PMVK Protein Vector (Mouse) (pPB-N-His)

    PV217467 500 ng
    EUR 603

    PMVK Protein Vector (Mouse) (pPM-C-HA)

    PV217468 500 ng
    EUR 603

    PMVK Protein Vector (Mouse) (pPM-C-His)

    PV217469 500 ng
    EUR 603

    PMVK Protein Vector (Mouse) (pPB-C-His)

    PV217470 500 ng
    EUR 603

    PMVK Protein Vector (Mouse) (pPB-N-His)

    PV217471 500 ng
    EUR 603

    PMVK Protein Vector (Mouse) (pPM-C-HA)

    PV217472 500 ng
    EUR 603

    PMVK Protein Vector (Mouse) (pPM-C-His)

    PV217473 500 ng
    EUR 603

    PMVK Protein Vector (Rat) (pPB-C-His)

    PV294866 500 ng
    EUR 603

    PMVK Protein Vector (Rat) (pPB-N-His)

    PV294867 500 ng
    EUR 603

    PMVK Protein Vector (Rat) (pPM-C-HA)

    PV294868 500 ng
    EUR 603

    PMVK Protein Vector (Rat) (pPM-C-His)

    PV294869 500 ng
    EUR 603

    Pmvk 3'UTR GFP Stable Cell Line

    TU166609 1.0 ml Ask for price

    PMVK 3'UTR Luciferase Stable Cell Line

    TU018344 1.0 ml
    EUR 1394

    Pmvk 3'UTR Luciferase Stable Cell Line

    TU116609 1.0 ml Ask for price

    PMVK 3'UTR GFP Stable Cell Line

    TU068344 1.0 ml
    EUR 1394

    Pmvk 3'UTR GFP Stable Cell Line

    TU266462 1.0 ml Ask for price

    Pmvk 3'UTR Luciferase Stable Cell Line

    TU216462 1.0 ml Ask for price

    VEGF Rabbit Polyclonal Antibody

    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    VEGF Rabbit Polyclonal Antibody

    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    WIPI2 Rabbit Polyclonal Antibody

    ES8580-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    WIPI2 Rabbit Polyclonal Antibody

    ES8580-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Gab1 Rabbit Polyclonal Antibody

    ES8582-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Gab1 Rabbit Polyclonal Antibody

    ES8582-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ERK1 Rabbit Polyclonal Antibody

    ES8583-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ERK1 Rabbit Polyclonal Antibody

    ES8583-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    PMVK Rabbit Polyclonal Antibody