OCLN Rabbit Polyclonal Antibody

OCLN Rabbit Polyclonal Antibody

Contact Us Below To Order :

    OCLN Polyclonal Antibody

    ABP59636-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human OCLN protein
    • Applications tips:
    Description: A polyclonal antibody for detection of OCLN from Human, Mouse, Rat. This OCLN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OCLN protein

    OCLN Polyclonal Antibody

    ABP59636-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human OCLN protein
    • Applications tips:
    Description: A polyclonal antibody for detection of OCLN from Human, Mouse, Rat. This OCLN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OCLN protein

    OCLN Polyclonal Antibody

    ABP59636-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human OCLN protein
    • Applications tips:
    Description: A polyclonal antibody for detection of OCLN from Human, Mouse, Rat. This OCLN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OCLN protein

    Human Occludin (OCLN) ELISA Kit

    DLR-OCLN-Hu-48T 48T
    EUR 517
    • Should the Human Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Occludin (OCLN) ELISA Kit

    DLR-OCLN-Hu-96T 96T
    EUR 673
    • Should the Human Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

    Mouse Occludin (OCLN) ELISA Kit

    DLR-OCLN-Mu-48T 48T
    EUR 527
    • Should the Mouse Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

    Mouse Occludin (OCLN) ELISA Kit

    DLR-OCLN-Mu-96T 96T
    EUR 688
    • Should the Mouse Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

    Rat Occludin (OCLN) ELISA Kit

    DLR-OCLN-Ra-48T 48T
    EUR 549
    • Should the Rat Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

    Rat Occludin (OCLN) ELISA Kit

    DLR-OCLN-Ra-96T 96T
    EUR 718
    • Should the Rat Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Occludin (OCLN) ELISA Kit

    RD-OCLN-Hu-48Tests 48 Tests
    EUR 521

    Human Occludin (OCLN) ELISA Kit

    RD-OCLN-Hu-96Tests 96 Tests
    EUR 723

    Mouse Occludin (OCLN) ELISA Kit

    RD-OCLN-Mu-48Tests 48 Tests
    EUR 533

    Mouse Occludin (OCLN) ELISA Kit

    RD-OCLN-Mu-96Tests 96 Tests
    EUR 740

    Rat Occludin (OCLN) ELISA Kit

    RD-OCLN-Ra-48Tests 48 Tests
    EUR 557

    Rat Occludin (OCLN) ELISA Kit

    RD-OCLN-Ra-96Tests 96 Tests
    EUR 775

    Human Occludin (OCLN) ELISA Kit

    RDR-OCLN-Hu-48Tests 48 Tests
    EUR 544

    Human Occludin (OCLN) ELISA Kit

    RDR-OCLN-Hu-96Tests 96 Tests
    EUR 756

    Mouse Occludin (OCLN) ELISA Kit

    RDR-OCLN-Mu-48Tests 48 Tests
    EUR 557

    Mouse Occludin (OCLN) ELISA Kit

    RDR-OCLN-Mu-96Tests 96 Tests
    EUR 774

    Rat Occludin (OCLN) ELISA Kit

    RDR-OCLN-Ra-48Tests 48 Tests
    EUR 583

    Rat Occludin (OCLN) ELISA Kit

    RDR-OCLN-Ra-96Tests 96 Tests
    EUR 811

    Rabbit OCLN ELISA Kit

    ERTO0016 96Tests
    EUR 521

    Polyclonal OCLN Antibody (C-term)

    APR17653G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OCLN (C-term). This antibody is tested and proven to work in the following applications:

    Occludin (OCLN) Polyclonal Antibody (Mouse)

    4-PAC228Mu01
    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN)

    OCLN Antibody

    35850-100ul 100ul
    EUR 252

    OCLN Antibody

    24902-100ul 100ul
    EUR 390

    OCLN antibody

    70R-19023 50 ul
    EUR 435
    Description: Rabbit polyclonal OCLN antibody

    OCLN Antibody

    1-CSB-PA385632
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

    OCLN Antibody

    1-CSB-PA190654
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

    OCLN Antibody

    1-CSB-PA016263GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    OCLN Antibody

    1-CSB-PA016263LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200

    OCLN

    RA34003 100 ul
    EUR 644

    Occludin (OCLN) Polyclonal Antibody (Mouse), APC

    4-PAC228Mu01-APC
    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with APC.

    Occludin (OCLN) Polyclonal Antibody (Mouse), Biotinylated

    4-PAC228Mu01-Biotin
    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with Biotin.

    Occludin (OCLN) Polyclonal Antibody (Mouse), Cy3

    4-PAC228Mu01-Cy3
    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with Cy3.

    Occludin (OCLN) Polyclonal Antibody (Mouse), FITC

    4-PAC228Mu01-FITC
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with FITC.

    Occludin (OCLN) Polyclonal Antibody (Mouse), HRP

    4-PAC228Mu01-HRP
    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with HRP.

    Occludin (OCLN) Polyclonal Antibody (Mouse), PE

    4-PAC228Mu01-PE
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with PE.

    Rabbit Occludin (OCLN) ELISA Kit

    abx362127-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    OCLN Conjugated Antibody

    C35850 100ul
    EUR 397

    Occludin (Ocln) Antibody

    20-abx114256
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    20-abx135728
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    20-abx100283
    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Occludin (OCLN) Antibody

    20-abx005226
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    abx027678-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    abx027678-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    20-abx173883
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Occludin (OCLN) Antibody

    20-abx173884
    • EUR 913.00
    • EUR 467.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Occludin (OCLN) Antibody

    20-abx177849
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Occludin (OCLN) Antibody

    20-abx177850
    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Occludin (OCLN) Antibody

    20-abx177851
    • EUR 1302.00
    • EUR 620.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Occludin (OCLN) Antibody

    20-abx213716
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    20-abx213972
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    20-abx217323
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    20-abx338520
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    abx235957-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Anti-OCLN antibody

    STJ111161 100 µl
    EUR 277
    Description: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5.

    Anti-OCLN antibody

    STJ114495 100 µl
    EUR 277
    Description: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5.

    Anti-OCLN antibody

    STJ192969 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to OCLN

    Ocln/ Rat Ocln ELISA Kit

    ELI-14841r 96 Tests
    EUR 886

    Occludin (OCLN) Polyclonal Antibody (Mouse), APC-Cy7

    4-PAC228Mu01-APC-Cy7
    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with APC-Cy7.

    OCLN siRNA

    20-abx903729
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    OCLN siRNA

    20-abx926764
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    OCLN siRNA

    20-abx926765
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Human(OCLN)

    QY-E05310 96T
    EUR 361

    Rabbit Anti-OCLN monoclonal antibody, clone KK102-19

    DCABH-5086 100 ul
    EUR 777

    Occludin (OCLN) Antibody (HRP)

    20-abx336871
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody (FITC)

    20-abx336872
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody (Biotin)

    20-abx336873
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody (Biotin)

    20-abx272823
    • EUR 467.00
    • EUR 244.00
    • EUR 1344.00
    • EUR 634.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    OCLN Antibody, HRP conjugated

    1-CSB-PA016263LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    OCLN Antibody, FITC conjugated

    1-CSB-PA016263LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    OCLN Antibody, Biotin conjugated

    1-CSB-PA016263LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Anti-Occludin/OCLN Antibody

    RP1057 100ug/vial
    EUR 334

    OCLN cloning plasmid

    CSB-CL016263HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1569
    • Sequence: atgtcatccaggcctcttgaaagtccacctccttacaggcctgatgaattcaaaccgaatcattatgcaccaagcaatgacatatatggtggagagatgcatgttcgaccaatgctctctcagccagcctactctttttacccagaagatgaaattcttcacttctacaaatgga
    • Show more
    Description: A cloning plasmid for the OCLN gene.

    Recombinant Occludin (OCLN)

    4-RPC228Mu01
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q61146
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 11.8kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Mouse Occludin expressed in: E.coli

    Anti-OCLN (5A7)

    YF-MA20378 100 ug
    EUR 363
    Description: Mouse monoclonal to OCLN

    Human Occludin (OCLN) Protein

    20-abx654597
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Rat Occludin (OCLN) Protein

    20-abx654599
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Rat OCLN shRNA Plasmid

    20-abx986766
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human OCLN ELISA Kit

    EHO0016 96Tests
    EUR 521

    Human OCLN ELISA Kit

    ELA-E14928h 96 Tests
    EUR 824

    Goat OCLN ELISA Kit

    EGTO0016 96Tests
    EUR 521

    Bovine OCLN ELISA Kit

    EBO0016 96Tests
    EUR 521

    CHICKEN OCLN ELISA KIT

    ECKO0016 96Tests
    EUR 521

    Canine OCLN ELISA Kit

    ECO0016 96Tests
    EUR 521

    Anserini OCLN ELISA Kit

    EAO0016 96Tests
    EUR 521

    Canine OCLN ELISA KIT

    ELI-13288d 96 Tests
    EUR 928

    OCLN ELISA KIT|Human

    EF005821 96 Tests
    EUR 689

    Porcine OCLN ELISA Kit

    EPO0016 96Tests
    EUR 521

    Rat OCLN ELISA Kit

    ERO0016 96Tests
    EUR 521

    Sheep OCLN ELISA Kit

    ESO0016 96Tests
    EUR 521

    Monkey OCLN ELISA Kit

    EMKO0016 96Tests
    EUR 521

    Mouse OCLN ELISA Kit

    EMO0016 96Tests
    EUR 521

    Mouse Occludin (OCLN) Protein

    20-abx068376
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Human OCLN shRNA Plasmid

    20-abx968922
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse OCLN shRNA Plasmid

    20-abx971853
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    OCLN Recombinant Protein (Human)

    RP022045 100 ug Ask for price

    OCLN Recombinant Protein (Rat)

    RP215030 100 ug Ask for price

    pCMV-SPORT6-OCLN Plasmid

    PVTB00550 2 ug
    EUR 356

    pLenti6/v5-OCLN Plasmid

    PVTB00550-2b 2 ug
    EUR 356

    OCLN Recombinant Protein (Mouse)

    RP155726 100 ug Ask for price

    Monoclonal OCLN Antibody (monoclonal) (M01), Clone: 1G7

    APR17654G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human OCLN (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1G7. This antibody is applicable in WB and IF, IP, E

    Chicken Occludin (OCLN) ELISA Kit

    abx517212-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Dog Occludin (OCLN) ELISA Kit

    abx517213-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Pig Occludin (OCLN) ELISA Kit

    abx361109-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Human Occludin (OCLN) ELISA Kit

    abx570647-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Mouse Occludin (OCLN) ELISA Kit

    abx572435-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Guinea Pig OCLN ELISA Kit

    EGO0016 96Tests
    EUR 521

    Mouse Ocln/ Occludin ELISA Kit

    E1073Mo 1 Kit
    EUR 632

    Human OCLN/ Occludin ELISA Kit

    E1819Hu 1 Kit
    EUR 605

    Human OCLN(Occludin) ELISA Kit

    EH1674 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: Q16625
    • Alias: OCLN(Occludin)/BLCPMG
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human Occludin, OCLN ELISA KIT

    ELI-21396h 96 Tests
    EUR 824

    Chicken Occludin, OCLN ELISA KIT

    ELI-22451c 96 Tests
    EUR 928

    Rat OCLN(Occludin) ELISA Kit

    ER1206 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: Q6P6T5
    • Alias: OCLN/BLCPMG
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

    Mouse Occludin, Ocln ELISA KIT

    ELI-44575m 96 Tests
    EUR 865

    Monkey OCLN(Occludin) ELISA Kit

    EMK0112 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Alias: Occludin
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Ape;Sensitivity: 0.094 ng/ml

    Rat Occludin (OCLN) ELISA Kit

    20-abx155925
    • EUR 7237.00
    • EUR 3855.00
    • EUR 895.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Occludin (OCLN) ELISA Kit

    20-abx154483
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Occludin (OCLN) ELISA Kit

    20-abx152580
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Occludin (OCLN) CLIA Kit

    abx195254-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Chicken Occludin (OCLN) ELISA Kit

    abx357187-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Human Occludin (OCLN) CLIA Kit

    20-abx493554
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Mouse Occludin (OCLN) CLIA Kit

    20-abx493555
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Rat Occludin (OCLN) CLIA Kit

    20-abx493556
    • EUR 8569.00
    • EUR 4560.00
    • EUR 1052.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Rat Occludin (OCLN) ELISA Kit

    abx255868-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Monkey Occludin (OCLN) ELISA Kit

    abx257872-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Human Occludin (OCLN) ELISA Kit

    abx250971-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Rat Occludin (Ocln) ELISA kit

    CSB-E17291r-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Rat Occludin (Ocln) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Rat Occludin (Ocln) ELISA kit

    1-CSB-E17291r
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Rat Occludin (Ocln) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Occludin(OCLN) ELISA kit

    CSB-EL016263HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Occludin (OCLN) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Occludin(OCLN) ELISA kit

    1-CSB-EL016263HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Occludin(OCLN) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    OCLN ORF Vector (Human) (pORF)

    ORF007349 1.0 ug DNA
    EUR 95

    Ocln ORF Vector (Rat) (pORF)

    ORF071678 1.0 ug DNA
    EUR 506

    Ocln ORF Vector (Mouse) (pORF)

    ORF051910 1.0 ug DNA
    EUR 506

    Human Occludin (OCLN) ELISA Kit

    SEC228Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

    Human Occludin (OCLN) ELISA Kit

    SEC228Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

    Human Occludin (OCLN) ELISA Kit

    SEC228Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

    Human Occludin (OCLN) ELISA Kit

    SEC228Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

    Human Occludin (OCLN) ELISA Kit

    4-SEC228Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Occludin elisa. Alternative names of the recognized antigen: Tight Junction Protein Occludin TM4 Minus
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Occludin (OCLN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Mouse Occludin (OCLN) ELISA Kit

    SEC228Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4862.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Occludin (OCLN) in Tissue homogenates, cell lysates and other biological fluids.

    Mouse Occludin (OCLN) ELISA Kit

    SEC228Mu-1x48wellstestplate 1x48-wells test plate
    EUR 488.08
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Occludin (OCLN) in Tissue homogenates, cell lysates and other biological fluids.

    Mouse Occludin (OCLN) ELISA Kit

    SEC228Mu-1x96wellstestplate 1x96-wells test plate
    EUR 654.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Occludin (OCLN) in Tissue homogenates, cell lysates and other biological fluids.

    Mouse Occludin (OCLN) ELISA Kit

    SEC228Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2644.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Occludin (OCLN) in Tissue homogenates, cell lysates and other biological fluids.

    Mouse Occludin (OCLN) ELISA Kit

    4-SEC228Mu
    • EUR 4913.00
    • EUR 2595.00
    • EUR 655.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Occludin elisa. Alternative names of the recognized antigen: Tight Junction Protein Occludin TM4 Minus
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Occludin (OCLN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Rat Occludin (OCLN) ELISA Kit

    SEC228Ra-10x96wellstestplate 10x96-wells test plate
    EUR 5124.2
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

    Rat Occludin (OCLN) ELISA Kit

    SEC228Ra-1x48wellstestplate 1x48-wells test plate
    EUR 509.64
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

    Rat Occludin (OCLN) ELISA Kit

    SEC228Ra-1x96wellstestplate 1x96-wells test plate
    EUR 685.2
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

    Rat Occludin (OCLN) ELISA Kit

    SEC228Ra-5x96wellstestplate 5x96-wells test plate
    EUR 2783.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

    Rat Occludin (OCLN) ELISA Kit

    4-SEC228Ra
    • EUR 5175.00
    • EUR 2734.00
    • EUR 686.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Occludin elisa. Alternative names of the recognized antigen: Tight Junction Protein Occludin TM4 Minus
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Occludin (OCLN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Occludin ELISA Kit (OCLN)

    RK01985 96 Tests
    EUR 605

    Mouse Occludin ELISA Kit (OCLN)

    RK03089 96 Tests
    EUR 521

    Rat Occludin ELISA Kit (OCLN)

    RK03859 96 Tests
    EUR 521

    Human Occludin(OCLN)ELISA Kit

    QY-E02189 96T
    EUR 413

    Rat Occludin(OCLN)ELISA kit

    QY-E10204 96T
    EUR 361

    Mouse Occludin(OCLN)ELISA kit

    QY-E21108 96T
    EUR 361

    pECMV-Ocln-m-FLAG Plasmid

    PVT15415 2 ug
    EUR 325

    OCLN ELISA Kit (Rat) (OKAN06300)

    OKAN06300 96 Wells
    EUR 792
    Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.123 ng/mL

    OCLN ELISA Kit (Mouse) (OKAN06459)

    OKAN06459 96 Wells
    EUR 792
    Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.132 ng/mL

    OCLN ELISA Kit (Human) (OKAN06498)

    OKAN06498 96 Wells
    EUR 792
    Description: Description of target: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

    OCLN ELISA Kit (Rat) (OKCD02739)

    OKCD02739 96 Wells
    EUR 896
    Description: Description of target: May play a role in the formation and regulation of the tight junction (TJ) paracellular permeability barrier. May be involved in the organization of actin in endothelial cells.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.123 ng/mL

    OCLN ELISA Kit (Mouse) (OKCD02772)

    OKCD02772 96 Wells
    EUR 857
    Description: Description of target: May play a role in the formation and regulation of the tight junction (TJ) paracellular permeability barrier.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: < 0.113 ng/mL

    OCLN ELISA Kit (Human) (OKCD08049)

    OKCD08049 96 Wells
    EUR 975
    Description: Description of target: OCLN is an integral membrane protein which is located at tight junctions. This protein may be involved in the formation and maintenance of the tight junction. The possibility of several alternatively spliced products has been suggested but the full nature of these products has not been described. This gene encodes an integral membrane protein which is located at tight junctions. This protein may be involved in the formation and maintenance of the tight junction. The possibility of several alternatively spliced products has been suggested but the full nature of these products has not been described. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

    OCLN ELISA Kit (Rat) (OKCA02244)

    OKCA02244 96 Wells
    EUR 833
    Description: Description of target: May play a role in the formation and regulation of the tight junction (TJ) paracellular permeability barrier. May be involved in the organization of actin in endothelial cells.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

    OCLN ELISA Kit (Mouse) (OKEH07095)

    OKEH07095 96 Wells
    EUR 779
    Description: Description of target: May play a role in the formation and regulation of the tight junction (TJ) paracellular permeability barrier. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

    OCLN ELISA Kit (Chicken) (OKEH08066)

    OKEH08066 96 Wells
    EUR 1184
    Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

    OCLN ELISA Kit (Dog) (OKEH08067)

    OKEH08067 96 Wells
    EUR 1184
    Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    ELISA kit for Human OCLN (Occludin)

    ELK3078 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Occludin (OCLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Occludin (OCLN). N
    • Show more
    Description: A sandwich ELISA kit for detection of Occludin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Rat OCLN (Occludin)

    ELK6134 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Occludin (OCLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Occludin (OCLN). N
    • Show more
    Description: A sandwich ELISA kit for detection of Occludin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Mouse OCLN (Occludin)

    ELK6145 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Occludin (OCLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Occludin (OCLN). N
    • Show more
    Description: A sandwich ELISA kit for detection of Occludin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    OCLN sgRNA CRISPR Lentivector set (Human)

    K1475401 3 x 1.0 ug
    EUR 339

    Ocln sgRNA CRISPR Lentivector set (Mouse)

    K4359401 3 x 1.0 ug
    EUR 339

    CLIA kit for Human OCLN (Occludin)

    E-CL-H0720 1 plate of 96 wells
    EUR 584
    • Gentaur's OCLN CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human OCLN . Standards or samples are added to the micro CLIA plate wells and combined with the
    • Show more
    Description: A sandwich CLIA kit for quantitative measurement of Human OCLN (Occludin) in samples from Serum, Plasma, Cell supernatant

    ELISA kit for Rat OCLN (Occludin)

    E-EL-R2503 1 plate of 96 wells
    EUR 534
    • Gentaur's OCLN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat OCLN. Standards or samples are added to the micro ELISA plate wells and combined with the
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Rat OCLN (Occludin) in samples from Serum, Plasma, Cell supernatant

    ELISA kit for Human OCLN (Occludin)

    E-EL-H1073 1 plate of 96 wells
    EUR 534
    • Gentaur's OCLN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human OCLN. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human OCLN (Occludin) in samples from Serum, Plasma, Cell supernatant

    Ocln sgRNA CRISPR Lentivector set (Rat)

    K7622601 3 x 1.0 ug
    EUR 339

    Ocln ELISA Kit| Mouse Occludin ELISA Kit

    EF015742 96 Tests
    EUR 689

    OCLN ELISA Kit| Rat Occludin ELISA Kit

    EF017927 96 Tests
    EUR 689

    OCLN ELISA Kit| chicken Occludin ELISA Kit

    EF012441 96 Tests
    EUR 689

    OCLN ELISA Kit| Monkey Occludin ELISA Kit

    EF012772 96 Tests
    EUR 689

    OCLN sgRNA CRISPR Lentivector (Human) (Target 1)

    K1475402 1.0 ug DNA
    EUR 154

    OCLN sgRNA CRISPR Lentivector (Human) (Target 2)

    K1475403 1.0 ug DNA
    EUR 154

    OCLN Rabbit Polyclonal Antibody