HMOX2 Rabbit Polyclonal Antibody

HMOX2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

HMOX2 Polyclonal Antibody

ABP58801-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HMOX2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HMOX2 from Human, Mouse, Rat. This HMOX2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HMOX2 protein

HMOX2 Rabbit pAb

A12713-100ul 100 ul
EUR 308

HMOX2 Rabbit pAb

A12713-200ul 200 ul
EUR 459

HMOX2 Rabbit pAb

A12713-20ul 20 ul
EUR 183

HMOX2 Rabbit pAb

A12713-50ul 50 ul
EUR 223

HMOX2 Rabbit pAb

A2745-100ul 100 ul
EUR 308

HMOX2 Rabbit pAb

A2745-200ul 200 ul
EUR 459

HMOX2 Rabbit pAb

A2745-20ul 20 ul
EUR 183

HMOX2 Rabbit pAb

A2745-50ul 50 ul
EUR 223

HMOX2 Antibody

ABD7071 100 ug
EUR 438

HMOX2 antibody

38455-100ul 100ul
EUR 252

HMOX2 Antibody

31081-100ul 100ul
EUR 252

HMOX2 Antibody

31081-50ul 50ul
EUR 187

HMOX2 antibody

10R-4361 100 ul
EUR 691
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody

10R-4362 100 ul
EUR 726
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody

10R-4364 100 ul
EUR 691
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody

10R-4365 100 ul
EUR 691
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody

10R-4366 100 ul
EUR 691
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody

10R-4367 100 ul
EUR 691
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody

10R-4368 100 ul
EUR 691
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody

20R-1346 100 ug
EUR 377
Description: Rabbit polyclonal HMOX2 antibody

HMOX2 antibody

70R-17767 50 ul
EUR 435
Description: Rabbit polyclonal HMOX2 antibody

HMOX2 antibody

70R-11796 100 ug
EUR 460
Description: Rabbit polyclonal HMOX2 antibody

HMOX2 antibody

70R-10556 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal HMOX2 antibody

HMOX2 Antibody

DF7071 200ul
EUR 304
Description: HMOX2 Antibody detects endogenous levels of total HMOX2.

HMOX2 Antibody

1-CSB-PA010584GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HMOX2. Recognizes HMOX2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

HMOX2 Antibody

1-CSB-PA204326
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMOX2. Recognizes HMOX2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

Polyclonal HMOX2 Antibody (N-term)

APR07778G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMOX2 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-HMOX2 Antibody

AMM05013G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMOX2 . This antibody is tested and proven to work in the following applications:

HMOX2 Conjugated Antibody

C38455 100ul
EUR 397

HMOX2 Conjugated Antibody

C31081 100ul
EUR 397

anti- HMOX2 antibody

FNab03938 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000 IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: heme oxygenase(decycling) 2
  • Uniprot ID: P30519
  • Gene ID: 3163
  • Research Area: Metabolism
Description: Antibody raised against HMOX2

Anti-HMOX2 antibody

PAab03938 100 ug
EUR 355

Anti-HMOX2 antibody

STJ71962 100 µg
EUR 359

Anti-HMOX2 antibody

STJ24054 100 µl
EUR 277
Description: Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene.

Anti-HMOX2 antibody

STJ114586 100 µl
EUR 277
Description: Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene.

Anti-HMOX2 antibody

STJ192960 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HMOX2

HMOX2 protein

30R-1470 100 ug
EUR 268
Description: Purified recombinant Human HMOX2 protein

Rabbit Heme Oxygenase 2 (HMOX2) ELISA Kit

abx363763-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Heme oxygenase 2, HMOX2 ELISA KIT

ELI-02122Ra 96 Tests
EUR 928

HMOX2 cloning plasmid

CSB-CL010584HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 951
  • Sequence: atgtcagcggaagtggaaacctcagagggggtagacgagtcagaaaaaaagaactctggggccctagaaaaggagaaccaaatgagaatggctgacctctcggagctcctgaaggaagggaccaaggaagcacacgaccgggcagaaaacacccagtttgtcaaggacttcttgaa
  • Show more
Description: A cloning plasmid for the HMOX2 gene.

HMOX2 Blocking Peptide

33R-6392 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMOX2 antibody, catalog no. 70R-10556

HMOX2 Blocking Peptide

33R-10740 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMOX2 antibody, catalog no. 70R-11796

HMOX2 Blocking Peptide

DF7071-BP 1mg
EUR 195

Heme Oxygenase 2 (HMOX2) Antibody

20-abx112961
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Heme Oxygenase 2 (HMOX2) Antibody

20-abx002076
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Heme Oxygenase 2 (HMOX2) Antibody

20-abx009166
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Heme Oxygenase 2 (HMOX2) Antibody

abx030942-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Heme Oxygenase 2 (HMOX2) Antibody

abx030942-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Heme Oxygenase 2 (HMOX2) Antibody

abx449920-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody

abx431325-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Heme Oxygenase 2 (HMOX2) Antibody

abx412240-50ug 50 ug
EUR 509
  • Shipped within 1 week.

Heme Oxygenase 2 (HMOX2) Antibody

abx448466-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody

abx233938-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Heme Oxygenase 2, Decycling (HMOX2) Antibody

20-abx214809
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Heme Oxygenase 2 (HMOX2) Antibody (APC)

abx449930-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (Biotin)

abx449931-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (FITC)

abx449932-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (HRP)

abx449933-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (PerCP)

abx449935-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (RPE)

abx449936-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (Streptavidin)

abx449937-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ALP)

abx447648-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (APC)

abx447649-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (Biotin)

abx447650-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (FITC)

abx447651-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (HRP)

abx447652-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (PerCP)

abx447654-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (RPE)

abx447655-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (Streptavidin)

abx447656-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Anti-Heme oxygenase 2/HMOX2 Antibody

PB9213 100ug/vial
EUR 334

Rat HMOX2 shRNA Plasmid

20-abx986530
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HMOX2 shRNA Plasmid

20-abx970829
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HMOX2 shRNA Plasmid

20-abx952159
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HMOX2 Recombinant Protein (Human)

RP015019 100 ug Ask for price

HMOX2 Recombinant Protein (Rat)

RP204779 100 ug Ask for price

HMOX2 Recombinant Protein (Mouse)

RP141929 100 ug Ask for price

HMOX2 Recombinant Protein (Mouse)

RP141932 100 ug Ask for price

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 390)

abx449921-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 488)

abx449922-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 565)

abx449923-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 594)

abx449924-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 633)

abx449925-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 655)

abx449926-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 680)

abx449927-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 700)

abx449928-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (Alkaline Phosphatase)

abx449929-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 390)

abx447640-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 488)

abx447641-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 565)

abx447642-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 594)

abx447643-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 633)

abx447644-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 655)

abx447645-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 680)

abx447646-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 700)

abx447647-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

HMOX2 ORF Vector (Human) (pORF)

ORF005007 1.0 ug DNA
EUR 95

Hmox2 ORF Vector (Rat) (pORF)

ORF068261 1.0 ug DNA
EUR 506

Hmox2 ORF Vector (Mouse) (pORF)

ORF047311 1.0 ug DNA
EUR 506

Hmox2 ORF Vector (Mouse) (pORF)

ORF047312 1.0 ug DNA
EUR 506

Monoclonal HMOX2 Antibody (monoclonal) (M01), Clone: 1D8-1A8

APR07777G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HMOX2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D8-1A8. This antibody is applicable in WB and IF, E

Heme Oxygenase 2 (HMOX2) Antibody (PE/ATTO 594)

abx449934-100ug 100 ug
EUR 620
  • Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (PE/ATTO 594)

abx447653-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Hmox2 sgRNA CRISPR Lentivector set (Mouse)

K4408701 3 x 1.0 ug
EUR 339

HMOX2 sgRNA CRISPR Lentivector set (Human)

K0974601 3 x 1.0 ug
EUR 339

Hmox2 sgRNA CRISPR Lentivector set (Rat)

K6761001 3 x 1.0 ug
EUR 339

Pig Heme Oxygenase 2 (HMOX2) ELISA Kit

abx360647-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Heme Oxygenase 2 (HMOX2) ELISA Kit

abx513440-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Heme Oxygenase 2 (HMOX2) ELISA Kit

abx513441-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Heme Oxygenase 2 (HMOX2) ELISA Kit

abx574071-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Hmox2/ Heme oxygenase 2 ELISA Kit

E0459Ra 1 Kit
EUR 571

Mouse Hmox2/ Heme oxygenase 2 ELISA Kit

E0685Mo 1 Kit
EUR 571

Human HMOX2/ Heme oxygenase 2 ELISA Kit

E1150Hu 1 Kit
EUR 571

Human Heme oxygenase 2, HMOX2 ELISA KIT

ELI-02119h 96 Tests
EUR 824

Mouse Heme oxygenase 2, Hmox2 ELISA KIT

ELI-02120m 96 Tests
EUR 865

Rat Heme oxygenase 2, Hmox2 ELISA KIT

ELI-02121r 96 Tests
EUR 886

Human Heme Oxygenase 2 (HMOX2) ELISA Kit

abx352045-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Sheep Heme Oxygenase 2 (HMOX2) ELISA Kit

abx364466-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Monkey Heme Oxygenase 2 (HMOX2) ELISA Kit

abx358677-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Heme Oxygenase 2 (HMOX2) ELISA Kit

abx355686-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Heme Oxygenase 2 (HMOX2) ELISA Kit

abx254182-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Hmox2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4408702 1.0 ug DNA
EUR 154

Hmox2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4408703 1.0 ug DNA
EUR 154

Hmox2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4408704 1.0 ug DNA
EUR 154

HMOX2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0974602 1.0 ug DNA
EUR 154

HMOX2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0974603 1.0 ug DNA
EUR 154

HMOX2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0974604 1.0 ug DNA
EUR 154

Hmox2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6761002 1.0 ug DNA
EUR 154

Hmox2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6761003 1.0 ug DNA
EUR 154

Hmox2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6761004 1.0 ug DNA
EUR 154

HMOX2 Heme Oxygenase-2 Human Recombinant Protein

PROTP30519 Regular: 25ug
EUR 317
Description: HMOX2 Human Recombinant produced in E.Coli is a single, non-glycosylated,_x000D_ polypeptide chain containing 264 amino acids (1-264 a.a.) and having a molecular mass of 30.5 kDa. _x000D_ HMOX2 is purified by proprietary chromatographic techniques._x000D_

Recombinant Human HMOX2 Protein, Untagged, E.coli-1mg

QP12287-1mg 1mg
EUR 2312

Recombinant Human HMOX2 Protein, Untagged, E.coli-25ug

QP12287-25ug 25ug
EUR 201

Recombinant Human HMOX2 Protein, Untagged, E.coli-5ug

QP12287-5ug 5ug
EUR 155

HMOX2 Protein Vector (Rat) (pPB-C-His)

PV273042 500 ng
EUR 603

HMOX2 Protein Vector (Rat) (pPB-N-His)

PV273043 500 ng
EUR 603

HMOX2 Protein Vector (Rat) (pPM-C-HA)

PV273044 500 ng
EUR 603

HMOX2 Protein Vector (Rat) (pPM-C-His)

PV273045 500 ng
EUR 603

HMOX2 Protein Vector (Human) (pPB-C-His)

PV020025 500 ng
EUR 329

HMOX2 Protein Vector (Human) (pPB-N-His)

PV020026 500 ng
EUR 329

HMOX2 Protein Vector (Human) (pPM-C-HA)

PV020027 500 ng
EUR 329

HMOX2 Protein Vector (Human) (pPM-C-His)

PV020028 500 ng
EUR 329

HMOX2 Protein Vector (Mouse) (pPB-C-His)

PV189242 500 ng
EUR 603

HMOX2 Protein Vector (Mouse) (pPB-N-His)

PV189243 500 ng
EUR 603

HMOX2 Protein Vector (Mouse) (pPM-C-HA)

PV189244 500 ng
EUR 603

HMOX2 Protein Vector (Mouse) (pPM-C-His)

PV189245 500 ng
EUR 603

HMOX2 Protein Vector (Mouse) (pPB-C-His)

PV189246 500 ng
EUR 603

HMOX2 Protein Vector (Mouse) (pPB-N-His)

PV189247 500 ng
EUR 603

HMOX2 Protein Vector (Mouse) (pPM-C-HA)

PV189248 500 ng
EUR 603

HMOX2 Protein Vector (Mouse) (pPM-C-His)

PV189249 500 ng
EUR 603

Hmox2 3'UTR Luciferase Stable Cell Line

TU205854 1.0 ml Ask for price

Hmox2 3'UTR GFP Stable Cell Line

TU159629 1.0 ml Ask for price

HMOX2 3'UTR Luciferase Stable Cell Line

TU010010 1.0 ml
EUR 1394

Hmox2 3'UTR Luciferase Stable Cell Line

TU109629 1.0 ml Ask for price

HMOX2 3'UTR GFP Stable Cell Line

TU060010 1.0 ml
EUR 1394

Hmox2 3'UTR GFP Stable Cell Line

TU255854 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HMOX2 Rabbit Polyclonal Antibody