HMOX2 Rabbit Polyclonal Antibody

HMOX2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    HMOX2 Polyclonal Antibody

    ABP58801-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human HMOX2 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of HMOX2 from Human, Mouse, Rat. This HMOX2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HMOX2 protein

    HMOX2 Rabbit pAb

    A12713-100ul 100 ul
    EUR 308

    HMOX2 Rabbit pAb

    A12713-200ul 200 ul
    EUR 459

    HMOX2 Rabbit pAb

    A12713-20ul 20 ul
    EUR 183

    HMOX2 Rabbit pAb

    A12713-50ul 50 ul
    EUR 223

    HMOX2 Rabbit pAb

    A2745-100ul 100 ul
    EUR 308

    HMOX2 Rabbit pAb

    A2745-200ul 200 ul
    EUR 459

    HMOX2 Rabbit pAb

    A2745-20ul 20 ul
    EUR 183

    HMOX2 Rabbit pAb

    A2745-50ul 50 ul
    EUR 223

    HMOX2 Antibody

    ABD7071 100 ug
    EUR 438

    HMOX2 antibody

    38455-100ul 100ul
    EUR 252

    HMOX2 Antibody

    31081-100ul 100ul
    EUR 252

    HMOX2 Antibody

    31081-50ul 50ul
    EUR 187

    HMOX2 antibody

    10R-4361 100 ul
    EUR 691
    Description: Mouse monoclonal HMOX2 antibody

    HMOX2 antibody

    10R-4362 100 ul
    EUR 726
    Description: Mouse monoclonal HMOX2 antibody

    HMOX2 antibody

    10R-4364 100 ul
    EUR 691
    Description: Mouse monoclonal HMOX2 antibody

    HMOX2 antibody

    10R-4365 100 ul
    EUR 691
    Description: Mouse monoclonal HMOX2 antibody

    HMOX2 antibody

    10R-4366 100 ul
    EUR 691
    Description: Mouse monoclonal HMOX2 antibody

    HMOX2 antibody

    10R-4367 100 ul
    EUR 691
    Description: Mouse monoclonal HMOX2 antibody

    HMOX2 antibody

    10R-4368 100 ul
    EUR 691
    Description: Mouse monoclonal HMOX2 antibody

    HMOX2 antibody

    20R-1346 100 ug
    EUR 377
    Description: Rabbit polyclonal HMOX2 antibody

    HMOX2 antibody

    70R-17767 50 ul
    EUR 435
    Description: Rabbit polyclonal HMOX2 antibody

    HMOX2 antibody

    70R-11796 100 ug
    EUR 460
    Description: Rabbit polyclonal HMOX2 antibody

    HMOX2 antibody

    70R-10556 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal HMOX2 antibody

    HMOX2 Antibody

    DF7071 200ul
    EUR 304
    Description: HMOX2 Antibody detects endogenous levels of total HMOX2.

    HMOX2 Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against HMOX2. Recognizes HMOX2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

    HMOX2 Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against HMOX2. Recognizes HMOX2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

    Polyclonal HMOX2 Antibody (N-term)

    APR07778G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMOX2 (N-term). This antibody is tested and proven to work in the following applications:

    Polyclonal Goat Anti-HMOX2 Antibody

    AMM05013G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMOX2 . This antibody is tested and proven to work in the following applications:

    HMOX2 Conjugated Antibody

    C38455 100ul
    EUR 397

    HMOX2 Conjugated Antibody

    C31081 100ul
    EUR 397

    anti- HMOX2 antibody

    FNab03938 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:1000
    • IP: 1:500-1:1000 IHC: 1:50-1:500
    • IF: 1:50-1:500
    • Immunogen: heme oxygenase(decycling) 2
    • Uniprot ID: P30519
    • Gene ID: 3163
    • Research Area: Metabolism
    Description: Antibody raised against HMOX2

    Anti-HMOX2 antibody

    PAab03938 100 ug
    EUR 355

    Anti-HMOX2 antibody

    STJ71962 100 µg
    EUR 359

    Anti-HMOX2 antibody

    STJ24054 100 µl
    EUR 277
    Description: Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene.

    Anti-HMOX2 antibody

    STJ114586 100 µl
    EUR 277
    Description: Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene.

    Anti-HMOX2 antibody

    STJ192960 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to HMOX2

    HMOX2 protein

    30R-1470 100 ug
    EUR 268
    Description: Purified recombinant Human HMOX2 protein

    Rabbit Heme Oxygenase 2 (HMOX2) ELISA Kit

    abx363763-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Rabbit Heme oxygenase 2, HMOX2 ELISA KIT

    ELI-02122Ra 96 Tests
    EUR 928

    HMOX2 cloning plasmid

    CSB-CL010584HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 951
    • Sequence: atgtcagcggaagtggaaacctcagagggggtagacgagtcagaaaaaaagaactctggggccctagaaaaggagaaccaaatgagaatggctgacctctcggagctcctgaaggaagggaccaaggaagcacacgaccgggcagaaaacacccagtttgtcaaggacttcttgaa
    • Show more
    Description: A cloning plasmid for the HMOX2 gene.

    HMOX2 Blocking Peptide

    33R-6392 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMOX2 antibody, catalog no. 70R-10556

    HMOX2 Blocking Peptide

    33R-10740 50 ug
    EUR 191
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMOX2 antibody, catalog no. 70R-11796

    HMOX2 Blocking Peptide

    DF7071-BP 1mg
    EUR 195

    Heme Oxygenase 2 (HMOX2) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Heme Oxygenase 2 (HMOX2) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Heme Oxygenase 2 (HMOX2) Antibody

    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Heme Oxygenase 2 (HMOX2) Antibody

    abx030942-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Heme Oxygenase 2 (HMOX2) Antibody

    abx030942-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Heme Oxygenase 2 (HMOX2) Antibody

    abx449920-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody

    abx431325-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Heme Oxygenase 2 (HMOX2) Antibody

    abx412240-50ug 50 ug
    EUR 509
    • Shipped within 1 week.

    Heme Oxygenase 2 (HMOX2) Antibody

    abx448466-100ug 100 ug
    EUR 523
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody

    abx233938-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Heme Oxygenase 2, Decycling (HMOX2) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (APC)

    abx449930-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (Biotin)

    abx449931-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (FITC)

    abx449932-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (HRP)

    abx449933-100ug 100 ug
    EUR 592
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (PerCP)

    abx449935-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (RPE)

    abx449936-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (Streptavidin)

    abx449937-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ALP)

    abx447648-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (APC)

    abx447649-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (Biotin)

    abx447650-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (FITC)

    abx447651-100ug 100 ug
    EUR 565
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (HRP)

    abx447652-100ug 100 ug
    EUR 565
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (PerCP)

    abx447654-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (RPE)

    abx447655-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (Streptavidin)

    abx447656-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Anti-Heme oxygenase 2/HMOX2 Antibody

    PB9213 100ug/vial
    EUR 334

    Rat HMOX2 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse HMOX2 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human HMOX2 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    HMOX2 Recombinant Protein (Human)

    RP015019 100 ug Ask for price

    HMOX2 Recombinant Protein (Rat)

    RP204779 100 ug Ask for price

    HMOX2 Recombinant Protein (Mouse)

    RP141929 100 ug Ask for price

    HMOX2 Recombinant Protein (Mouse)

    RP141932 100 ug Ask for price

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 390)

    abx449921-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 488)

    abx449922-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 565)

    abx449923-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 594)

    abx449924-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 633)

    abx449925-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 655)

    abx449926-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 680)

    abx449927-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 700)

    abx449928-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (Alkaline Phosphatase)

    abx449929-100ug 100 ug
    EUR 606
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 390)

    abx447640-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 488)

    abx447641-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 565)

    abx447642-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 594)

    abx447643-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 633)

    abx447644-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 655)

    abx447645-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 680)

    abx447646-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (ATTO 700)

    abx447647-100ug 100 ug
    EUR 578
    • Shipped within 5-12 working days.

    HMOX2 ORF Vector (Human) (pORF)

    ORF005007 1.0 ug DNA
    EUR 95

    Hmox2 ORF Vector (Rat) (pORF)

    ORF068261 1.0 ug DNA
    EUR 506

    Hmox2 ORF Vector (Mouse) (pORF)

    ORF047311 1.0 ug DNA
    EUR 506

    Hmox2 ORF Vector (Mouse) (pORF)

    ORF047312 1.0 ug DNA
    EUR 506

    HMOX2 ELISA Kit (Human) (OKCD06551)

    OKCD06551 96 Wells
    EUR 753
    Description: Description of target: HEME oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to bilirubin by biliverdin reductase. Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

    HMOX2 ELISA Kit (Rat) (OKEH03158)

    OKEH03158 96 Wells
    EUR 662
    Description: Description of target: Heme oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to bilirubin by biliverdin reductase. Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed. Heme oxygenase 2 could be implicated in the production of carbon monoxide in brain where it could act as a neurotransmitter.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78U/L

    HMOX2 ELISA Kit (Human) (OKCA02278)

    OKCA02278 96 Wells
    EUR 930
    Description: Description of target: Heme oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to bilirubin by biliverdin reductase. Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed. Heme oxygenase 2 could be implicated in the production of carbon monoxide in brain where it could act as a neurotransmitter. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.08 ng/mL

    Monoclonal HMOX2 Antibody (monoclonal) (M01), Clone: 1D8-1A8

    APR07777G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human HMOX2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D8-1A8. This antibody is applicable in WB and IF, E

    Heme Oxygenase 2 (HMOX2) Antibody (PE/ATTO 594)

    abx449934-100ug 100 ug
    EUR 620
    • Shipped within 5-12 working days.

    Heme Oxygenase 2 (HMOX2) Antibody (PE/ATTO 594)

    abx447653-100ug 100 ug
    EUR 592
    • Shipped within 5-12 working days.

    Hmox2 sgRNA CRISPR Lentivector set (Mouse)

    K4408701 3 x 1.0 ug
    EUR 339

    HMOX2 sgRNA CRISPR Lentivector set (Human)

    K0974601 3 x 1.0 ug
    EUR 339

    Hmox2 sgRNA CRISPR Lentivector set (Rat)

    K6761001 3 x 1.0 ug
    EUR 339

    Pig Heme Oxygenase 2 (HMOX2) ELISA Kit

    abx360647-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Human Heme Oxygenase 2 (HMOX2) ELISA Kit

    abx513440-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Mouse Heme Oxygenase 2 (HMOX2) ELISA Kit

    abx513441-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Rat Heme Oxygenase 2 (HMOX2) ELISA Kit

    abx574071-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Rat Hmox2/ Heme oxygenase 2 ELISA Kit

    E0459Ra 1 Kit
    EUR 571

    Mouse Hmox2/ Heme oxygenase 2 ELISA Kit

    E0685Mo 1 Kit
    EUR 571

    Human HMOX2/ Heme oxygenase 2 ELISA Kit

    E1150Hu 1 Kit
    EUR 571

    Human Heme oxygenase 2, HMOX2 ELISA KIT

    ELI-02119h 96 Tests
    EUR 824

    Mouse Heme oxygenase 2, Hmox2 ELISA KIT

    ELI-02120m 96 Tests
    EUR 865

    Rat Heme oxygenase 2, Hmox2 ELISA KIT

    ELI-02121r 96 Tests
    EUR 886

    Human Heme Oxygenase 2 (HMOX2) ELISA Kit

    abx352045-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Sheep Heme Oxygenase 2 (HMOX2) ELISA Kit

    abx364466-96tests 96 tests
    EUR 926
    • Shipped within 5-12 working days.

    Monkey Heme Oxygenase 2 (HMOX2) ELISA Kit

    abx358677-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Chicken Heme Oxygenase 2 (HMOX2) ELISA Kit

    abx355686-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Mouse Heme Oxygenase 2 (HMOX2) ELISA Kit

    abx254182-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Hmox2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4408702 1.0 ug DNA
    EUR 154

    Hmox2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4408703 1.0 ug DNA
    EUR 154

    Hmox2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4408704 1.0 ug DNA
    EUR 154

    HMOX2 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0974602 1.0 ug DNA
    EUR 154

    HMOX2 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0974603 1.0 ug DNA
    EUR 154

    HMOX2 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0974604 1.0 ug DNA
    EUR 154

    Hmox2 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6761002 1.0 ug DNA
    EUR 154

    Hmox2 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6761003 1.0 ug DNA
    EUR 154

    Hmox2 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6761004 1.0 ug DNA
    EUR 154

    HMOX2 Heme Oxygenase-2 Human Recombinant Protein

    PROTP30519 Regular: 25ug
    EUR 317
    Description: HMOX2 Human Recombinant produced in E.Coli is a single, non-glycosylated,_x000D_ polypeptide chain containing 264 amino acids (1-264 a.a.) and having a molecular mass of 30.5 kDa. _x000D_ HMOX2 is purified by proprietary chromatographic techniques._x000D_

    Recombinant Human HMOX2 Protein, Untagged, E.coli-1mg

    QP12287-1mg 1mg
    EUR 2312

    Recombinant Human HMOX2 Protein, Untagged, E.coli-25ug

    QP12287-25ug 25ug
    EUR 201

    Recombinant Human HMOX2 Protein, Untagged, E.coli-5ug

    QP12287-5ug 5ug
    EUR 155

    HMOX2 Protein Vector (Rat) (pPB-C-His)

    PV273042 500 ng
    EUR 603

    HMOX2 Protein Vector (Rat) (pPB-N-His)

    PV273043 500 ng
    EUR 603

    HMOX2 Protein Vector (Rat) (pPM-C-HA)

    PV273044 500 ng
    EUR 603

    HMOX2 Protein Vector (Rat) (pPM-C-His)

    PV273045 500 ng
    EUR 603

    HMOX2 Protein Vector (Human) (pPB-C-His)

    PV020025 500 ng
    EUR 329

    HMOX2 Protein Vector (Human) (pPB-N-His)

    PV020026 500 ng
    EUR 329

    HMOX2 Protein Vector (Human) (pPM-C-HA)

    PV020027 500 ng
    EUR 329

    HMOX2 Protein Vector (Human) (pPM-C-His)

    PV020028 500 ng
    EUR 329

    HMOX2 Protein Vector (Mouse) (pPB-C-His)

    PV189242 500 ng
    EUR 603

    HMOX2 Protein Vector (Mouse) (pPB-N-His)

    PV189243 500 ng
    EUR 603

    HMOX2 Protein Vector (Mouse) (pPM-C-HA)

    PV189244 500 ng
    EUR 603

    HMOX2 Protein Vector (Mouse) (pPM-C-His)

    PV189245 500 ng
    EUR 603

    HMOX2 Protein Vector (Mouse) (pPB-C-His)

    PV189246 500 ng
    EUR 603

    HMOX2 Protein Vector (Mouse) (pPB-N-His)

    PV189247 500 ng
    EUR 603

    HMOX2 Protein Vector (Mouse) (pPM-C-HA)

    PV189248 500 ng
    EUR 603

    HMOX2 Protein Vector (Mouse) (pPM-C-His)

    PV189249 500 ng
    EUR 603

    Hmox2 3'UTR Luciferase Stable Cell Line

    TU205854 1.0 ml Ask for price

    Hmox2 3'UTR GFP Stable Cell Line

    TU159629 1.0 ml Ask for price

    HMOX2 3'UTR Luciferase Stable Cell Line

    TU010010 1.0 ml
    EUR 1394

    Hmox2 3'UTR Luciferase Stable Cell Line

    TU109629 1.0 ml Ask for price

    HMOX2 3'UTR GFP Stable Cell Line

    TU060010 1.0 ml
    EUR 1394

    Hmox2 3'UTR GFP Stable Cell Line

    TU255854 1.0 ml Ask for price

    Hmox2 ELISA Kit (Mouse) : 96 Wells (OKEH02777)

    OKEH02777 96 Wells
    EUR 662
    Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.166 ng/mL

    VEGF Rabbit Polyclonal Antibody

    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    VEGF Rabbit Polyclonal Antibody

    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HMOX2 Rabbit Polyclonal Antibody