THYN1 Rabbit Polyclonal Antibody

THYN1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    THYN1 Polyclonal Antibody

    ES11801-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against THYN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    THYN1 Polyclonal Antibody

    ES11801-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against THYN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    THYN1 antibody

    70R-20818 50 ul
    EUR 435
    Description: Rabbit polyclonal THYN1 antibody

    THYN1 Antibody

    40147-100ul 100ul
    EUR 252

    THYN1 Antibody

    1-CSB-PA693156
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against THYN1. Recognizes THYN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

    THYN1 Antibody

    1-CSB-PA187498
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against THYN1. Recognizes THYN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

    THYN1 antibody

    70R-3715 50 ug
    EUR 467
    Description: Rabbit polyclonal THYN1 antibody raised against the middle region of THYN1

    THYN1 antibody

    70R-4037 50 ug
    EUR 467
    Description: Rabbit polyclonal THYN1 antibody raised against the N terminal of THYN1

    THYN1 Antibody

    1-CSB-PA023526GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against THYN1. Recognizes THYN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    Human THYN1 Antibody

    32297-05111 150 ug
    EUR 261

    THYN1 Conjugated Antibody

    C40147 100ul
    EUR 397

    anti- THYN1 antibody

    FNab08682 100µg
    EUR 548.75
    • Immunogen: thymocyte nuclear protein 1
    • Uniprot ID: Q9P016
    • Gene ID: 29087
    • Research Area: Cell Division and Proliferation, Cancer
    Description: Antibody raised against THYN1

    Anti-THYN1 antibody

    PAab08682 100 ug
    EUR 386

    Anti-THYN1 antibody

    STJ192959 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to THYN1

    Thyn1/ Rat Thyn1 ELISA Kit

    ELI-52045r 96 Tests
    EUR 886

    THYN1 siRNA

    20-abx905570
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    THYN1 siRNA

    20-abx936748
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    THYN1 siRNA

    20-abx936749
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human)

    4-PAC791Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser225)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1)

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat)

    4-PAC791Ra01
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser226)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1)

    THYN1 Blocking Peptide

    33R-6487 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of THYN1 antibody, catalog no. 70R-4037

    THYN1 Blocking Peptide

    33R-6820 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of THYN1 antibody, catalog no. 70R-3715

    THYN1 cloning plasmid

    CSB-CL023526HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 501
    • Sequence: atgtcgagaccccggaagaggctggctgggacttctggttcagacaagggactatcaggaaaacgcaccaaaactgagaactcaggtgaggcattagctaaagtggaggactccaaccctcagaagacttcagccactaaaaactgtttgaagaatctaagcagccactggctgat
    • Show more
    Description: A cloning plasmid for the THYN1 gene.

    Human THYN1 Antibody (Biotin Conjugate)

    32297-05121 150 ug
    EUR 369

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), APC

    4-PAC791Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser225)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), Biotinylated

    4-PAC791Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser225)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Biotin.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), Cy3

    4-PAC791Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser225)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Cy3.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), FITC

    4-PAC791Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser225)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with FITC.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), HRP

    4-PAC791Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser225)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with HRP.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), PE

    4-PAC791Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser225)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with PE.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), APC

    4-PAC791Ra01-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser226)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), Biotinylated

    4-PAC791Ra01-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser226)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Biotin.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), Cy3

    4-PAC791Ra01-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser226)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Cy3.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), FITC

    4-PAC791Ra01-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser226)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with FITC.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), HRP

    4-PAC791Ra01-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser226)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with HRP.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), PE

    4-PAC791Ra01-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser226)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with PE.

    Rabbit Thymocyte nuclear protein 1(THYN1) ELISA kit

    E04T0692-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Thymocyte nuclear protein 1(THYN1) ELISA kit

    E04T0692-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Thymocyte nuclear protein 1(THYN1) ELISA kit

    E04T0692-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human THYN1 AssayLite Antibody (FITC Conjugate)

    32297-05141 150 ug
    EUR 428

    Human THYN1 AssayLite Antibody (RPE Conjugate)

    32297-05151 150 ug
    EUR 428

    Human THYN1 AssayLite Antibody (APC Conjugate)

    32297-05161 150 ug
    EUR 428

    Human THYN1 AssayLite Antibody (PerCP Conjugate)

    32297-05171 150 ug
    EUR 471

    Thymocyte Nuclear Protein 1 (THYN1) Antibody

    20-abx211306
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Thymocyte Nuclear Protein 1 (THYN1) Antibody

    20-abx116090
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Thymocyte Nuclear Protein 1 (THYN1) Antibody

    20-abx131638
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Thymocyte Nuclear Protein 1 (THYN1) Antibody

    20-abx131639
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Thymocyte Nuclear Protein 1 (THYN1) Antibody

    abx238682-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Thymocyte Nuclear Protein 1 (THYN1) Antibody

    20-abx339588
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    THYN1 protein (His tag)

    80R-1522 100 ug
    EUR 305
    Description: Purified recombinant Human THYN1 protein

    THYN1 ELISA KIT|Human

    EF003598 96 Tests
    EUR 689

    Rat THYN1 shRNA Plasmid

    20-abx989056
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse THYN1 shRNA Plasmid

    20-abx978838
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human THYN1 shRNA Plasmid

    20-abx959180
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    THYN1 Recombinant Protein (Rat)

    RP233099 100 ug Ask for price

    THYN1 Recombinant Protein (Human)

    RP031534 100 ug Ask for price

    THYN1 Recombinant Protein (Mouse)

    RP178676 100 ug Ask for price

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), APC-Cy7

    4-PAC791Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser225)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC-Cy7.

    Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), APC-Cy7

    4-PAC791Ra01-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: THYN1 (Met1~Ser226)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC-Cy7.

    Thyn1 ORF Vector (Rat) (pORF)

    ORF077701 1.0 ug DNA
    EUR 506

    THYN1 ORF Vector (Human) (pORF)

    ORF010512 1.0 ug DNA
    EUR 95

    Thyn1 ORF Vector (Mouse) (pORF)

    ORF059560 1.0 ug DNA
    EUR 506

    Thyn1 sgRNA CRISPR Lentivector set (Mouse)

    K4954201 3 x 1.0 ug
    EUR 339

    Thyn1 sgRNA CRISPR Lentivector set (Rat)

    K7166101 3 x 1.0 ug
    EUR 339

    THYN1 sgRNA CRISPR Lentivector set (Human)

    K2372401 3 x 1.0 ug
    EUR 339

    Recombinant Thymocyte Nuclear Protein 1 (THYN1)

    4-RPC791Hu01
    • EUR 386.72
    • EUR 206.00
    • EUR 1175.20
    • EUR 458.40
    • EUR 816.80
    • EUR 322.00
    • EUR 2788.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9P016
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 29.4kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Thymocyte Nuclear Protein 1 expressed in: E.coli

    Recombinant Thymocyte Nuclear Protein 1 (THYN1)

    4-RPC791Ra01
    • EUR 440.48
    • EUR 221.00
    • EUR 1376.80
    • EUR 525.60
    • EUR 951.20
    • EUR 358.00
    • EUR 3292.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q6P3E0
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 29.8kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Rat Thymocyte Nuclear Protein 1 expressed in: E.coli

    Human Thymocyte Nuclear Protein 1 (THYN1) Protein

    20-abx650181
    • EUR 551.00
    • EUR 244.00
    • EUR 1595.00
    • EUR 648.00
    • EUR 411.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Rat Thymocyte Nuclear Protein 1 (THYN1) Protein

    20-abx650182
    • EUR 620.00
    • EUR 272.00
    • EUR 1859.00
    • EUR 732.00
    • EUR 453.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Thyn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4954202 1.0 ug DNA
    EUR 154

    Thyn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4954203 1.0 ug DNA
    EUR 154

    Thyn1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4954204 1.0 ug DNA
    EUR 154

    Thyn1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7166102 1.0 ug DNA
    EUR 154

    Thyn1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7166103 1.0 ug DNA
    EUR 154

    Thyn1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7166104 1.0 ug DNA
    EUR 154

    THYN1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K2372402 1.0 ug DNA
    EUR 154

    THYN1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K2372403 1.0 ug DNA
    EUR 154

    THYN1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K2372404 1.0 ug DNA
    EUR 154

    THYN1 Protein Vector (Rat) (pPB-C-His)

    PV310802 500 ng
    EUR 603

    THYN1 Protein Vector (Rat) (pPB-N-His)

    PV310803 500 ng
    EUR 603

    THYN1 Protein Vector (Rat) (pPM-C-HA)

    PV310804 500 ng
    EUR 603

    THYN1 Protein Vector (Rat) (pPM-C-His)

    PV310805 500 ng
    EUR 603

    THYN1 Protein Vector (Human) (pPB-C-His)

    PV042045 500 ng
    EUR 329

    THYN1 Protein Vector (Human) (pPB-N-His)

    PV042046 500 ng
    EUR 329

    THYN1 Protein Vector (Human) (pPM-C-HA)

    PV042047 500 ng
    EUR 329

    THYN1 Protein Vector (Human) (pPM-C-His)

    PV042048 500 ng
    EUR 329

    THYN1 Protein Vector (Mouse) (pPB-C-His)

    PV238238 500 ng
    EUR 603

    THYN1 Protein Vector (Mouse) (pPB-N-His)

    PV238239 500 ng
    EUR 603

    THYN1 Protein Vector (Mouse) (pPM-C-HA)

    PV238240 500 ng
    EUR 603

    THYN1 Protein Vector (Mouse) (pPM-C-His)

    PV238241 500 ng
    EUR 603

    Recombinant Human THYN1 Protein, His, E.coli-1mg

    QP13747-1mg 1mg
    EUR 2757

    Recombinant Human THYN1 Protein, His, E.coli-20ug

    QP13747-20ug 20ug
    EUR 201

    Recombinant Human THYN1 Protein, His, E.coli-5ug

    QP13747-5ug 5ug
    EUR 155

    Thyn1 3'UTR Luciferase Stable Cell Line

    TU120479 1.0 ml Ask for price

    Thyn1 3'UTR GFP Stable Cell Line

    TU170479 1.0 ml Ask for price

    Thyn1 3'UTR Luciferase Stable Cell Line

    TU221879 1.0 ml Ask for price

    THYN1 3'UTR GFP Stable Cell Line

    TU075565 1.0 ml
    EUR 1394

    Thyn1 3'UTR GFP Stable Cell Line

    TU271879 1.0 ml Ask for price

    THYN1 3'UTR Luciferase Stable Cell Line

    TU025565 1.0 ml
    EUR 1394

    GAPDH Rabbit Polyclonal Antibody

    37985-100ul 100ul
    EUR 252

    GAPDH Rabbit Polyclonal Antibody

    37985-50ul 50ul
    EUR 187

    EFHD1 Rabbit Polyclonal Antibody

    38001-100ul 100ul
    EUR 252

    EFHD1 Rabbit Polyclonal Antibody

    38001-50ul 50ul
    EUR 187

    Alliinase Rabbit Polyclonal Antibody

    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody

    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody

    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody

    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody

    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody

    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody

    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody

    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody

    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody

    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody

    38086-100ul 100ul
    EUR 252

    AmCyan Rabbit Polyclonal Antibody

    38086-50ul 50ul
    EUR 187

    EBFP Rabbit Polyclonal Antibody

    38087-100ul 100ul
    EUR 252

    EBFP Rabbit Polyclonal Antibody

    38087-50ul 50ul
    EUR 187

    Vimentin Rabbit Polyclonal Antibody

    38104-100ul 100ul
    EUR 252

    Vimentin Rabbit Polyclonal Antibody

    38104-50ul 50ul
    EUR 187

    LDHD Rabbit Polyclonal Antibody

    38105-100ul 100ul
    EUR 252

    LDHD Rabbit Polyclonal Antibody

    38105-50ul 50ul
    EUR 187

    GAPDH Rabbit Polyclonal Antibody

    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Rabbit Hemoglobin Polyclonal Antibody

    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    VEGF Rabbit Polyclonal Antibody

    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    CD10 Rabbit Polyclonal Antibody

    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    NM23A Rabbit Polyclonal Antibody

    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    ATM Rabbit Polyclonal Antibody

    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    THYN1 Rabbit Polyclonal Antibody