TXLNA Rabbit Polyclonal Antibody

TXLNA Rabbit Polyclonal Antibody

Contact Us Below To Order :

TXLNA Polyclonal Antibody
ABP60797-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TXLNA protein
  • Applications tips:
Description: A polyclonal antibody for detection of TXLNA from Human, Mouse. This TXLNA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TXLNA protein
TXLNA Polyclonal Antibody
ABP60797-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TXLNA protein
  • Applications tips:
Description: A polyclonal antibody for detection of TXLNA from Human, Mouse. This TXLNA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TXLNA protein
TXLNA Polyclonal Antibody
ABP60797-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TXLNA protein
  • Applications tips:
Description: A polyclonal antibody for detection of TXLNA from Human, Mouse. This TXLNA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TXLNA protein
Human Taxilin Alpha (TXLNa) ELISA Kit
DLR-TXLNa-Hu-48T 48T
EUR 498
  • Should the Human Taxilin Alpha (TXLNa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Taxilin Alpha (TXLNa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Taxilin Alpha (TXLNa) ELISA Kit
DLR-TXLNa-Hu-96T 96T
EUR 647
  • Should the Human Taxilin Alpha (TXLNa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Taxilin Alpha (TXLNa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Taxilin Alpha (TXLNa) ELISA Kit
RDR-TXLNa-Hu-48Tests 48 Tests
EUR 522
Human Taxilin Alpha (TXLNa) ELISA Kit
RDR-TXLNa-Hu-96Tests 96 Tests
EUR 724
Human Taxilin Alpha (TXLNa) ELISA Kit
RD-TXLNa-Hu-48Tests 48 Tests
EUR 500
Human Taxilin Alpha (TXLNa) ELISA Kit
RD-TXLNa-Hu-96Tests 96 Tests
EUR 692
TXLNA Rabbit pAb
A18291-100ul 100 ul
EUR 308
TXLNA Rabbit pAb
A18291-200ul 200 ul
EUR 459
TXLNA Rabbit pAb
A18291-20ul 20 ul
EUR 183
TXLNA Rabbit pAb
A18291-50ul 50 ul
EUR 223
Rabbit TXLNa ELISA Kit
ERTT0382 96Tests
EUR 521
TXLNA antibody
70R-35826 100 ug
EUR 349
Description: Rabbit polyclonal TXLNA antibody
TXLNA Antibody
36551-100ul 100ul
EUR 252
TXLNA Antibody
1-CSB-PA843964
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TXLNA. Recognizes TXLNA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
TXLNA Antibody
1-CSB-PA234430
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TXLNA. Recognizes TXLNA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
Polyclonal TXLNA Antibody - C-terminal region
APR01617G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TXLNA - C-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal TXLNA Antibody - N-terminal region
APR01618G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TXLNA - N-terminal region. This antibody is tested and proven to work in the following applications:
Taxilin Alpha (TXLNa) Polyclonal Antibody (Human)
4-PAB182Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa)
[KO Validated] TXLNA Rabbit pAb
A19889-100ul 100 ul
EUR 410
[KO Validated] TXLNA Rabbit pAb
A19889-200ul 200 ul
EUR 571
[KO Validated] TXLNA Rabbit pAb
A19889-20ul 20 ul
EUR 221
[KO Validated] TXLNA Rabbit pAb
A19889-50ul 50 ul
EUR 287
TXLNA Conjugated Antibody
C36551 100ul
EUR 397
Anti-TXLNA antibody
STJ11100247 100 µl
EUR 277
Anti-TXLNA antibody
STJ11100765 100 µl
EUR 413
Anti-TXLNA antibody
STJ192946 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TXLNA
Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), APC
4-PAB182Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with APC.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), Biotinylated
4-PAB182Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with Biotin.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), Cy3
4-PAB182Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with Cy3.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), FITC
4-PAB182Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with FITC.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), HRP
4-PAB182Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with HRP.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), PE
4-PAB182Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with PE.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat)
4-PAB182Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa)
Rabbit Taxilin Alpha (TXLNa) ELISA Kit
abx362715-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Alpha-taxilin(TXLNA) ELISA kit
E04A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha-taxilin(TXLNA) ELISA kit
E04A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha-taxilin(TXLNA) ELISA kit
E04A2018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
TXLNA siRNA
20-abx938635
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TXLNA siRNA
20-abx938636
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Taxilin Alpha (TXLNa) Antibody
20-abx128767
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Taxilin Alpha (TXLNa) Antibody
20-abx129547
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Taxilin Alpha (TXLNA) Antibody
abx037110-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Taxilin Alpha (TXLNa) Antibody
20-abx174724
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
Taxilin Alpha (TXLNA) Antibody
20-abx213218
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Taxilin Alpha (TXLNA) Antibody
20-abx213510
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), APC-Cy7
4-PAB182Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with APC-Cy7.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), APC
4-PAB182Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with APC.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAB182Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with Biotin.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAB182Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with Cy3.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), FITC
4-PAB182Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with FITC.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), HRP
4-PAB182Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with HRP.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), PE
4-PAB182Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with PE.
TXLNA cloning plasmid
CSB-CL025363HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1641
  • Sequence: ATGAAGAACCAAGACAAAAAGAACGGGGCTGCCAAACAATCCAATCCAAAAAGCAGCCCAGGACAACCGGAAGCAGGACCCGAGGGAGCCCAGGAGCGGCCCAGCCAGGCGGCTCCTGCAGTAGAAGCAGAAGGTCCCGGCAGCAGCCAGGCTCCTCGGAAGCCGGAGGGGGCTC
  • Show more
Description: A cloning plasmid for the TXLNA gene.
TXLNA cloning plasmid
CSB-CL025363HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1641
  • Sequence: ATGAAGAACCAAGACAAAAAGAACGGGGCTGCCAAACAATCCAATCCAAAAAGCAGCCCAGGACAACCGGAAGCAGGACCCGAGGGAGCCCAGGAGCGGCCCAGCCAGGCGGCTCCTGCAGTAGAAGCAGAAGGTCCCGGCAGCAGCCAGGCTCCTCGGAAGCCGGAGGGGGCTC
  • Show more
Description: A cloning plasmid for the TXLNA gene.
Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAB182Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with APC-Cy7.
Active Taxilin Alpha (TXLNa)
4-APB182Hu01
  • EUR 777.38
  • EUR 311.00
  • EUR 2640.16
  • EUR 946.72
  • EUR 1793.44
  • EUR 583.00
  • EUR 6450.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P40222
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.4kDa
  • Isoelectric Point: 7.8
Description: Recombinant Human Taxilin Alpha expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells
Mouse TXLNA shRNA Plasmid
20-abx980010
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TXLNA ELISA Kit
EHT0382 96Tests
EUR 521
Goat TXLNA ELISA Kit
EGTT0382 96Tests
EUR 521
Bovine TXLNA ELISA Kit
EBT0382 96Tests
EUR 521
Chicken TXLNA ELISA Kit
ECKT0382 96Tests
EUR 521
Anserini TXLNa ELISA Kit
EAT0382 96Tests
EUR 521
Canine TXLNA ELISA Kit
ECT0382 96Tests
EUR 521
Human TXLNA ELISA Kit
ELA-E9023h 96 Tests
EUR 824
TXLNA ELISA KIT|Human
EF006468 96 Tests
EUR 689
Porcine TXLNA ELISA Kit
EPT0382 96Tests
EUR 521
Rat TXLNA ELISA Kit
ERT0382 96Tests
EUR 521
Sheep TXLNA ELISA Kit
EST0382 96Tests
EUR 521
Monkey TXLNA ELISA Kit
EMKT0382 96Tests
EUR 521
Mouse TXLNA ELISA Kit
EMT0382 96Tests
EUR 521
Human TXLNA shRNA Plasmid
20-abx966233
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TXLNA Recombinant Protein (Human)
RP044575 100 ug Ask for price
TXLNA Recombinant Protein (Human)
RP044578 100 ug Ask for price
Recombinant Taxilin Alpha (TXLNa)
4-RPB182Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P40222
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.4kDa
  • Isoelectric Point: 7.8
Description: Recombinant Human Taxilin Alpha expressed in: E.coli
Recombinant Taxilin Alpha (TXLNa)
4-RPB182Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6PAM1
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 57.7kDa
  • Isoelectric Point: 6.3
Description: Recombinant Mouse Taxilin Alpha expressed in: E.coli
TXLNA Recombinant Protein (Rat)
RP235364 100 ug Ask for price
TXLNA Recombinant Protein (Mouse)
RP182360 100 ug Ask for price
TXLNA Recombinant Protein (Mouse)
RP182363 100 ug Ask for price
Guinea Pig TXLNA ELISA Kit
EGT0382 96Tests
EUR 521
Mouse Taxilin Alpha (TXLNa) Protein
20-abx168348
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Taxilin Alpha (TXLNa) Protein
20-abx166674
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Txlna ORF Vector (Rat) (pORF)
ORF078456 1.0 ug DNA
EUR 506
TXLNA ORF Vector (Human) (pORF)
ORF014859 1.0 ug DNA
EUR 354
TXLNA ORF Vector (Human) (pORF)
ORF014860 1.0 ug DNA
EUR 354
Txlna ORF Vector (Mouse) (pORF)
ORF060788 1.0 ug DNA
EUR 506
Txlna ORF Vector (Mouse) (pORF)
ORF060789 1.0 ug DNA
EUR 506
Mouse Alpha-taxilin (TXLNA) ELISA Kit
abx520928-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Pig Taxilin Alpha (TXLNa) ELISA Kit
abx360898-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Taxilin Alpha (TXLNa) ELISA Kit
20-abx585187
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Alpha-taxilin (TXLNA) ELISA Kit
abx574971-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Goat Alpha-taxilin(TXLNA) ELISA kit
E06A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha-taxilin(TXLNA) ELISA kit
E06A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha-taxilin(TXLNA) ELISA kit
E06A2018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha-taxilin(TXLNA) ELISA kit
E01A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha-taxilin(TXLNA) ELISA kit
E01A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha-taxilin(TXLNA) ELISA kit
E01A2018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha-taxilin(TXLNA) ELISA kit
E03A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha-taxilin(TXLNA) ELISA kit
E03A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha-taxilin(TXLNA) ELISA kit
E03A2018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha-taxilin(TXLNA) ELISA kit
E02A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha-taxilin(TXLNA) ELISA kit
E02A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha-taxilin(TXLNA) ELISA kit
E02A2018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Alpha-taxilin(TXLNA) ELISA kit
E07A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Alpha-taxilin(TXLNA) ELISA kit
E07A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Alpha-taxilin(TXLNA) ELISA kit
E07A2018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Alpha-taxilin(TXLNA) ELISA kit
E09A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Alpha-taxilin(TXLNA) ELISA kit
E09A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Alpha-taxilin(TXLNA) ELISA kit
E09A2018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Alpha-taxilin(TXLNA) ELISA kit
E08A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Alpha-taxilin(TXLNA) ELISA kit
E08A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Alpha-taxilin(TXLNA) ELISA kit
E08A2018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Txlna/ Alpha-taxilin ELISA Kit
E1545Mo 1 Kit
EUR 632
Human TXLNA/ Alpha-taxilin ELISA Kit
E2611Hu 1 Kit
EUR 605
Human TXLNA(Alpha-taxilin) ELISA Kit
EH2425 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P40222
  • Alias: TXLNA/IL-14/alpha-taxilin/IL14/interleukin 14/taxilin alpha/TXLN
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Mouse Alpha- taxilin, Txlna ELISA KIT
ELI-17051m 96 Tests
EUR 865
Human Alpha- taxilin, TXLNA ELISA KIT
ELI-40213h 96 Tests
EUR 824
Mouse Txlna(Alpha-taxilin) ELISA Kit
EM0803 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q6PAM1
  • Alias: Txlna/TXLNA/IL-14/alpha-taxilin/IL14/interleukin 14/taxilin alpha/TXLN
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml
Human Taxilin alpha (TXLNa) ELISA Kit
20-abx153234
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Rat Taxilin Alpha (TXLNa) ELISA Kit
abx353957-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Chicken Taxilin Alpha (TXLNa) ELISA Kit
abx356265-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Monkey Taxilin Alpha (TXLNa) ELISA Kit
abx358954-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Taxilin alpha (TXLNa) CLIA Kit
20-abx492473
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Taxilin Alpha (TXLNa) ELISA Kit
abx255151-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Taxilin Alpha (TXLNa) ELISA Kit
abx251787-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
TXLNA sgRNA CRISPR Lentivector set (Human)
K2563001 3 x 1.0 ug
EUR 339
Txlna sgRNA CRISPR Lentivector set (Mouse)
K4762601 3 x 1.0 ug
EUR 339
Txlna sgRNA CRISPR Lentivector set (Rat)
K7494201 3 x 1.0 ug
EUR 339
Human Taxilin Alpha (TXLNa) ELISA Kit
SEB182Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Taxilin Alpha (TXLNa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Taxilin Alpha (TXLNa) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Taxilin Alpha (TXLNa) ELISA Kit
SEB182Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Taxilin Alpha (TXLNa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Taxilin Alpha (TXLNa) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Taxilin Alpha (TXLNa) ELISA Kit
SEB182Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Taxilin Alpha (TXLNa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Taxilin Alpha (TXLNa) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Taxilin Alpha (TXLNa) ELISA Kit
SEB182Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Taxilin Alpha (TXLNa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Taxilin Alpha (TXLNa) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Taxilin Alpha (TXLNa) ELISA Kit
4-SEB182Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Taxilin Alpha elisa. Alternative names of the recognized antigen: IL14
  • TXLN
  • HMW-BCGF
  • High Molecular Weight B-Cell Growth Factor
  • Interleukin 14
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Taxilin Alpha (TXLNa) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mouse Taxilin Alpha (TXLNa) ELISA Kit
SEB182Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Taxilin Alpha (TXLNa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Taxilin Alpha (TXLNa) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

TXLNA Rabbit Polyclonal Antibody