CD3G Rabbit Polyclonal Antibody

CD3G Rabbit Polyclonal Antibody

Contact Us Below To Order :

CD3G Polyclonal Antibody

ABP58067-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CD3G protein
  • Applications tips:
Description: A polyclonal antibody for detection of CD3G from Human, Mouse, Rat. This CD3G antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD3G protein

CD3G Rabbit pAb

A1938-100ul 100 ul
EUR 308

CD3G Rabbit pAb

A1938-200ul 200 ul
EUR 459

CD3G Rabbit pAb

A1938-20ul 20 ul
EUR 183

CD3G Rabbit pAb

A1938-50ul 50 ul Ask for price

CD3g antibody

70R-51259 100 ul
EUR 244
Description: Purified Polyclonal CD3g antibody

CD3G Antibody

ABD8098 100 ug
EUR 438

CD3G Antibody

ABD8099 100 ug
EUR 438

CD3G Antibody

49836-100ul 100ul
EUR 333

CD3G Antibody

49836-50ul 50ul
EUR 239

CD3G Antibody

45216-100ul 100ul
EUR 252

CD3G Antibody

45216-50ul 50ul
EUR 187

CD3G antibody

70R-16274 50 ul
EUR 435
Description: Rabbit polyclonal CD3G antibody

CD3G Antibody

DF8098 200ul
EUR 304
Description: CD3G Antibody detects endogenous levels of total CD3G.

CD3G Antibody

1-CSB-PA004933GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CD3G Antibody

1-CSB-PA004933LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

CD3G

PR27294 5 ug
EUR 318

CD3G Conjugated Antibody

C49836 100ul
EUR 397

Human CD3G Antibody

35697-05111 150 ug
EUR 261

Anti-CD3G antibody

STJ73095 100 µg
EUR 359

Anti-CD3G antibody

STJ28124 100 µl
EUR 277
Description: The protein encoded by this gene is the CD3-gamma polypeptide, which together with CD3-epsilon, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. Defects in this gene are associated with T cell immunodeficiency.

Anti-CD3G Antibody

STJ500451 100 µg
EUR 476

Anti-CD3G antibody

STJ192944 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CD3G

Cd3g/ Rat Cd3g ELISA Kit

ELI-25761r 96 Tests
EUR 886

Polyclonal Goat Anti-CD3G Antibody (internal region)

APG00967G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CD3G (internal region). This antibody is tested and proven to work in the following applications:

CD3G siRNA

20-abx900911
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD3G siRNA

20-abx911027
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD3G siRNA

20-abx911028
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD3G recombinant monoclonal antibody

A5842 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human CD3G for WB,ELISA

CD3G Antibody, HRP conjugated

1-CSB-PA004933LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CD3G Antibody, FITC conjugated

1-CSB-PA004933LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CD3G Antibody, Biotin conjugated

1-CSB-PA004933LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CD3G Antibody (Biotin)

STJ500466 100 µg
EUR 586

Anti-CD3G Antibody (FITC)

STJ500467 100 µg
EUR 586

CD3G cloning plasmid

CSB-CL004933HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 549
  • Sequence: ATGGAACAGGGGAAGGGCCTGGCTGTCCTCATCCTGGCTATCATTCTTCTTCAAGGTACTTTGGCCCAGTCAATCAAAGGAAACCACTTGGTTAAGGTGTATGACTATCAAGAAGATGGTTCGGTACTTCTGACTTGTGATGCAGAAGCCAAAAATATCACATGGTTTAAAGATGG
  • Show more
Description: A cloning plasmid for the CD3G gene.

CD3g Blocking Peptide

20-abx064134
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CD3G, human recombinant

7313-100
EUR 370

CD3G Blocking Peptide

DF8098-BP 1mg
EUR 195

Human CD3G Antibody (Biotin Conjugate)

35697-05121 150 ug
EUR 369

Human CD3G AssayLite Antibody (FITC Conjugate)

35697-05141 150 ug
EUR 428

Human CD3G AssayLite Antibody (RPE Conjugate)

35697-05151 150 ug
EUR 428

Human CD3G AssayLite Antibody (APC Conjugate)

35697-05161 150 ug
EUR 428

Human CD3G AssayLite Antibody (PerCP Conjugate)

35697-05171 150 ug
EUR 471

Rat CD3G shRNA Plasmid

20-abx989067
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CD3G ELISA Kit

ELA-E10023h 96 Tests
EUR 824

Mouse Cd3g ELISA KIT

ELI-10625m 96 Tests
EUR 865

Human CD3G ELISA KIT

ELI-10660h 96 Tests
EUR 824

Bovine CD3G ELISA KIT

ELI-50827b 96 Tests
EUR 928

Human CD3G shRNA Plasmid

20-abx950646
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD3G protein (His tag)

80R-2704 100 ug
EUR 322
Description: Purified recombinant CD3G protein (His tag)

Mouse CD3G shRNA Plasmid

20-abx969567
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD3G Recombinant Protein (Human)

RP037918 100 ug Ask for price

CD3G Recombinant Protein (Rat)

RP193961 100 ug Ask for price

CD3G Recombinant Protein (Mouse)

RP122588 100 ug Ask for price

Cd3g ORF Vector (Mouse) (pORF)

ORF040864 1.0 ug DNA
EUR 506

CD3G ORF Vector (Human) (pORF)

ORF012640 1.0 ug DNA
EUR 95

Cd3g ORF Vector (Rat) (pORF)

ORF064655 1.0 ug DNA
EUR 506

CD3G sgRNA CRISPR Lentivector set (Human)

K0399801 3 x 1.0 ug
EUR 339

Cd3g sgRNA CRISPR Lentivector set (Mouse)

K3425401 3 x 1.0 ug
EUR 339

Cd3g sgRNA CRISPR Lentivector set (Rat)

K6288201 3 x 1.0 ug
EUR 339

CD3G CD3 Gamma Human Recombinant Protein

PROTP09693 Regular: 20ug
EUR 317
Description: CD3G Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 117 amino acids (23-116a.a.) and having a molecular mass of 13.1kDa. CD3G is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

h CD3g (6His) inducible lentiviral particles

LVP1093 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing C-terminal His-Tagged human target: CD3g (6His) (human CD3g molecule), [alternative names: CD3-GAMMA; IMD17; T3G]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000073.2 . It contains a RFP-Blasticidin dual selection marker.

T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody

20-abx123523
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody

20-abx111481
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody

20-abx149086
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3g) Antibody

20-abx007885
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody

abx028446-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody

abx028446-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

T-cell surface glycoprotein CD3 gamma chain (CD3G) Antibody

20-abx338816
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody

abx431152-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Recombinant CD3E&CD3G Heterodimer Protein (Asp 23-Asp 126 (CD3E) & Gln 23-Ser 116 (CD3G)) [Fc]

VAng-1294Lsx-1mg 1 mg
EUR 7749
Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc,His Tag&Fc,Flag Tag, is expressed in HEK 293 cells. (Uniprot ID: NP_000724.1 (CD3E) & AAI13831 (CD3G))

Recombinant CD3E&CD3G Heterodimer Protein (Asp 23-Asp 126 (CD3E) & Gln 23-Ser 116 (CD3G)) [Fc]

VAng-1294Lsx-50g 50 µg
EUR 1013
Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc,His Tag&Fc,Flag Tag, is expressed in HEK 293 cells. (Uniprot ID: NP_000724.1 (CD3E) & AAI13831 (CD3G))

Recombinant CD3E&CD3G Heterodimer Protein (Gln 22-Asp 117 (CD3E) & Gln 23-Thr 113 (CD3G)) [Fc]

VAng-1295Lsx-100g 100 µg
EUR 1013
Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc Tag, is expressed in HEK 293 cells. (Uniprot ID: Q95LI5-1 (CD3E) & Q95LI7-1 (CD3G))

Recombinant CD3E&CD3G Heterodimer Protein (Gln 22-Asp 117 (CD3E) & Gln 23-Thr 113 (CD3G)) [Fc]

VAng-1295Lsx-1mg 1 mg
EUR 6402
Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc Tag, is expressed in HEK 293 cells. (Uniprot ID: Q95LI5-1 (CD3E) & Q95LI7-1 (CD3G))

CD3G sgRNA CRISPR Lentivector (Human) (Target 1)

K0399802 1.0 ug DNA
EUR 154

CD3G sgRNA CRISPR Lentivector (Human) (Target 2)

K0399803 1.0 ug DNA
EUR 154

CD3G sgRNA CRISPR Lentivector (Human) (Target 3)

K0399804 1.0 ug DNA
EUR 154

Cd3g sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3425402 1.0 ug DNA
EUR 154

Cd3g sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3425403 1.0 ug DNA
EUR 154

Cd3g sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3425404 1.0 ug DNA
EUR 154

Cd3g sgRNA CRISPR Lentivector (Rat) (Target 1)

K6288202 1.0 ug DNA
EUR 154

Cd3g sgRNA CRISPR Lentivector (Rat) (Target 2)

K6288203 1.0 ug DNA
EUR 154

Cd3g sgRNA CRISPR Lentivector (Rat) (Target 3)

K6288204 1.0 ug DNA
EUR 154

CD3G Protein Vector (Human) (pPB-C-His)

PV050557 500 ng
EUR 481

CD3G Protein Vector (Human) (pPB-N-His)

PV050558 500 ng
EUR 481

CD3G Protein Vector (Human) (pPM-C-HA)

PV050559 500 ng
EUR 481

CD3G Protein Vector (Human) (pPM-C-His)

PV050560 500 ng
EUR 481

Recombinant Human CD3G Protein, His, Insect-1mg

QP11332-HIS-1mg 1mg
EUR 2757

Recombinant Human CD3G Protein, His, Insect-1ug

QP11332-HIS-1ug 1ug
EUR 155

Recombinant Human CD3G Protein, His, Insect-20ug

QP11332-HIS-20ug 20ug
EUR 201

Recombinant Human CD3G Protein, His, Insect-50ug

QP11332-HIS-50ug 50ug
EUR 1261

Recombinant Human CD3G Protein, His, E.coli-5ug

QP11332-HIS-EC-5ug 5ug
EUR 155

Recombinant Human CD3G Protein, His, Insect-5ug

QP11332-HIS-INSECT-5ug 5ug
EUR 201

CD3G Protein Vector (Rat) (pPB-C-His)

PV258618 500 ng
EUR 603

CD3G Protein Vector (Rat) (pPB-N-His)

PV258619 500 ng
EUR 603

CD3G Protein Vector (Rat) (pPM-C-HA)

PV258620 500 ng
EUR 603

CD3G Protein Vector (Rat) (pPM-C-His)

PV258621 500 ng
EUR 603

CD3G Protein Vector (Mouse) (pPB-C-His)

PV163454 500 ng
EUR 603

CD3G Protein Vector (Mouse) (pPB-N-His)

PV163455 500 ng
EUR 603

CD3G Protein Vector (Mouse) (pPM-C-HA)

PV163456 500 ng
EUR 603

CD3G Protein Vector (Mouse) (pPM-C-His)

PV163457 500 ng
EUR 603

Cd3g 3'UTR Luciferase Stable Cell Line

TU201978 1.0 ml Ask for price

Cd3g 3'UTR GFP Stable Cell Line

TU153504 1.0 ml Ask for price

CD3G 3'UTR Luciferase Stable Cell Line

TU003865 1.0 ml
EUR 1394

Cd3g 3'UTR Luciferase Stable Cell Line

TU103504 1.0 ml Ask for price

CD3G 3'UTR GFP Stable Cell Line

TU053865 1.0 ml
EUR 1394

Cd3g 3'UTR GFP Stable Cell Line

TU251978 1.0 ml Ask for price

T-cell surface glycoprotein CD3 gamma chain (CD3G) Antibody (HRP)

20-abx337913
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-cell surface glycoprotein CD3 gamma chain (CD3G) Antibody (FITC)

20-abx337914
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-cell surface glycoprotein CD3 gamma chain (CD3G) Antibody (Biotin)

20-abx337915
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD3G Rabbit Polyclonal Antibody