PANK2 Rabbit Polyclonal Antibody

PANK2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    PANK2 Rabbit pAb

    A18502-100ul 100 ul
    EUR 308

    PANK2 Rabbit pAb

    A18502-200ul 200 ul
    EUR 459

    PANK2 Rabbit pAb

    A18502-20ul 20 ul
    EUR 183

    PANK2 Rabbit pAb

    A18502-50ul 50 ul
    EUR 223

    PANK2 antibody

    70R-19106 50 ul
    EUR 435
    Description: Rabbit polyclonal PANK2 antibody

    PANK2 antibody

    10R-5154 100 ul
    EUR 691
    Description: Mouse monoclonal PANK2 antibody

    PANK2 antibody

    10R-5155 100 ul
    EUR 726
    Description: Mouse monoclonal PANK2 antibody

    PANK2 Antibody

    45374-100ul 100ul
    EUR 252

    PANK2 Antibody

    45374-50ul 50ul
    EUR 187

    PANK2 Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

    PANK2 Antibody

    DF8588 200ul
    EUR 304
    Description: PANK2 Antibody detects endogenous levels of total PANK2.

    PANK2 Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    PANK2 antibody

    70R-51108 100 ul
    EUR 244
    Description: Purified Polyclonal PANK2 antibody

    PANK2 Antibody

    ABD8588 100 ug
    EUR 438

    Polyclonal PANK2 Antibody (N-term)

    APR08921G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PANK2 (N-term). This antibody is tested and proven to work in the following applications:

    Anti-PANK2 Antibody

    A02776 100ul
    EUR 397
    Description: Rabbit Polyclonal PANK2 Antibody. Validated in WB and tested in Human.

    PANK2 Conjugated Antibody

    C45374 100ul
    EUR 397

    anti- PANK2 antibody

    FNab06134 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:1000
    • IP: 1:500-1:1000
    • IHC: 1:10-1:100
    • IF: 1:10-1:100
    • Immunogen: pantothenate kinase 2
    • Uniprot ID: Q9BZ23
    • Gene ID: 80025
    • Research Area: Metabolism
    Description: Antibody raised against PANK2

    Anti-PANK2 antibody

    PAab06134 100 ug
    EUR 355

    Anti-PANK2 antibody

    STJ11100453 100 µl
    EUR 277

    Anti-PANK2 antibody

    STJ192933 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to PANK2

    PANK2 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.


    PVT12303 2 ug
    EUR 391

    PANK2 Antibody, HRP conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    PANK2 Antibody, FITC conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    PANK2 Antibody, Biotin conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    PANK2 Blocking Peptide

    DF8588-BP 1mg
    EUR 195

    PANK2 Blocking Peptide

    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    PANK2 cloning plasmid

    CSB-CL874850HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 405
    • Sequence: atggcatctcgtggagatagcaccaaagtggataaactagtacgagatatttatggaggggactatgagaggtttggactgccaggctgggctgtggcttcaagctttggaaacatgatgagcaaggagaagcgagaggctgtcagtaaagaggacctggccagagcgactttgat
    • Show more
    Description: A cloning plasmid for the PANK2 gene.

    Anti-PANK2 (2B12)

    YF-MA11671 100 ug
    EUR 363
    Description: Mouse monoclonal to PANK2

    Pantothenate Kinase 2 (PANK2) Antibody

    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Pantothenate Kinase 2 (PANK2) Antibody

    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Pantothenate Kinase 2 (PANK2) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Pantothenate Kinase 2 (PANK2) Antibody

    abx236134-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Pantothenate Kinase 2 (PANK2) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.


    EF001546 96 Tests
    EUR 689

    Human PANK2 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    PANK2 Recombinant Protein (Human)

    RP022510 100 ug Ask for price

    PANK2 Recombinant Protein (Mouse)

    RP160031 100 ug Ask for price

    PANK2 Recombinant Protein (Rat)

    RP219233 100 ug Ask for price

    Pantothenate Kinase 2 (PANK2) Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Pantothenate Kinase 2 (PANK2) Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Pantothenate Kinase 2 (PANK2) Antibody (Biotin)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Pank2 ORF Vector (Rat) (pORF)

    ORF073079 1.0 ug DNA
    EUR 506

    PANK2 ORF Vector (Human) (pORF)

    ORF007504 1.0 ug DNA
    EUR 95

    Pank2 ORF Vector (Mouse) (pORF)

    ORF053345 1.0 ug DNA
    EUR 506

    pECMV-Pank2-m-FLAG Plasmid

    PVT14904 2 ug
    EUR 325

    Pank2 sgRNA CRISPR Lentivector set (Rat)

    K6058401 3 x 1.0 ug
    EUR 339

    Pank2 sgRNA CRISPR Lentivector set (Mouse)

    K4027701 3 x 1.0 ug
    EUR 339

    PANK2 sgRNA CRISPR Lentivector set (Human)

    K1591501 3 x 1.0 ug
    EUR 339

    Human Pantothenate Kinase 2 (PANK2) ELISA Kit

    abx382044-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Pank2 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6058402 1.0 ug DNA
    EUR 154

    Pank2 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6058403 1.0 ug DNA
    EUR 154

    Pank2 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6058404 1.0 ug DNA
    EUR 154

    Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4027702 1.0 ug DNA
    EUR 154

    Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4027703 1.0 ug DNA
    EUR 154

    Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4027704 1.0 ug DNA
    EUR 154

    PANK2 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1591502 1.0 ug DNA
    EUR 154

    PANK2 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1591503 1.0 ug DNA
    EUR 154

    PANK2 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1591504 1.0 ug DNA
    EUR 154

    PANK2 Protein Vector (Rat) (pPB-C-His)

    PV292314 500 ng
    EUR 603

    PANK2 Protein Vector (Rat) (pPB-N-His)

    PV292315 500 ng
    EUR 603

    PANK2 Protein Vector (Rat) (pPM-C-HA)

    PV292316 500 ng
    EUR 603

    PANK2 Protein Vector (Rat) (pPM-C-His)

    PV292317 500 ng
    EUR 603

    PANK2 Protein Vector (Mouse) (pPB-C-His)

    PV213378 500 ng
    EUR 603

    PANK2 Protein Vector (Mouse) (pPB-N-His)

    PV213379 500 ng
    EUR 603

    PANK2 Protein Vector (Mouse) (pPM-C-HA)

    PV213380 500 ng
    EUR 603

    PANK2 Protein Vector (Mouse) (pPM-C-His)

    PV213381 500 ng
    EUR 603

    PANK2 Protein Vector (Human) (pPB-C-His)

    PV030013 500 ng
    EUR 329

    PANK2 Protein Vector (Human) (pPB-N-His)

    PV030014 500 ng
    EUR 329

    PANK2 Protein Vector (Human) (pPM-C-HA)

    PV030015 500 ng
    EUR 329

    PANK2 Protein Vector (Human) (pPM-C-His)

    PV030016 500 ng
    EUR 329

    Human Pantothenate Kinase 2(PANK2)ELISA Kit

    QY-E03648 96T
    EUR 361

    Pank2 3'UTR Luciferase Stable Cell Line

    TU115879 1.0 ml Ask for price

    Pank2 3'UTR GFP Stable Cell Line

    TU165879 1.0 ml Ask for price

    Pank2 3'UTR Luciferase Stable Cell Line

    TU215788 1.0 ml Ask for price

    Pank2 3'UTR GFP Stable Cell Line

    TU265788 1.0 ml Ask for price

    PANK2 3'UTR GFP Stable Cell Line

    TU067363 1.0 ml
    EUR 2333

    PANK2 3'UTR Luciferase Stable Cell Line

    TU017363 1.0 ml
    EUR 2333

    Human Pantothenate kinase 2, mitochondrial, PANK2 ELISA KIT

    ELI-37781h 96 Tests
    EUR 824

    GAPDH Rabbit Polyclonal Antibody

    37985-100ul 100ul
    EUR 252

    GAPDH Rabbit Polyclonal Antibody

    37985-50ul 50ul
    EUR 187

    EFHD1 Rabbit Polyclonal Antibody

    38001-100ul 100ul
    EUR 252

    EFHD1 Rabbit Polyclonal Antibody

    38001-50ul 50ul
    EUR 187

    Alliinase Rabbit Polyclonal Antibody

    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody

    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody

    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody

    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody

    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody

    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody

    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody

    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody

    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody

    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody

    38086-100ul 100ul
    EUR 252

    AmCyan Rabbit Polyclonal Antibody

    38086-50ul 50ul
    EUR 187

    EBFP Rabbit Polyclonal Antibody

    38087-100ul 100ul
    EUR 252

    EBFP Rabbit Polyclonal Antibody

    38087-50ul 50ul
    EUR 187

    Vimentin Rabbit Polyclonal Antibody

    38104-100ul 100ul
    EUR 252

    Vimentin Rabbit Polyclonal Antibody

    38104-50ul 50ul
    EUR 187

    LDHD Rabbit Polyclonal Antibody

    38105-100ul 100ul
    EUR 252

    LDHD Rabbit Polyclonal Antibody

    38105-50ul 50ul
    EUR 187

    GAPDH Rabbit Polyclonal Antibody

    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Rabbit Hemoglobin Polyclonal Antibody

    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    VEGF Rabbit Polyclonal Antibody

    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    PANK2 Rabbit Polyclonal Antibody