MATR3 Rabbit Polyclonal Antibody

MATR3 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    MATR3 Polyclonal Antibody
    ES11773-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MATR3. This antibody is tested and validated for WB, ELISA, WB, ELISA
    MATR3 Polyclonal Antibody
    ES11773-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MATR3. This antibody is tested and validated for WB, ELISA, WB, ELISA
    Human Matrin 3 (MATR3) ELISA Kit
    DLR-MATR3-Hu-48T 48T
    EUR 517
    • Should the Human Matrin 3 (MATR3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Matrin 3 (MATR3) in samples from tissue homogenates or other biological fluids.
    Human Matrin 3 (MATR3) ELISA Kit
    DLR-MATR3-Hu-96T 96T
    EUR 673
    • Should the Human Matrin 3 (MATR3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Matrin 3 (MATR3) in samples from tissue homogenates or other biological fluids.
    Human Matrin 3 (MATR3) ELISA Kit
    RDR-MATR3-Hu-48Tests 48 Tests
    EUR 544
    Human Matrin 3 (MATR3) ELISA Kit
    RDR-MATR3-Hu-96Tests 96 Tests
    EUR 756
    Human Matrin 3 (MATR3) ELISA Kit
    RD-MATR3-Hu-48Tests 48 Tests
    EUR 521
    Human Matrin 3 (MATR3) ELISA Kit
    RD-MATR3-Hu-96Tests 96 Tests
    EUR 723
    MATR3 Rabbit pAb
    A5905-100ul 100 ul
    EUR 308
    MATR3 Rabbit pAb
    A5905-200ul 200 ul
    EUR 459
    MATR3 Rabbit pAb
    A5905-20ul 20 ul
    EUR 183
    MATR3 Rabbit pAb
    A5905-50ul 50 ul
    EUR 223
    MATR3 antibody
    70R-18424 50 ul
    EUR 435
    Description: Rabbit polyclonal MATR3 antibody
    MATR3 Antibody
    36602-100ul 100ul
    EUR 252
    MATR3 antibody
    10R-1442 50 ug
    EUR 242
    Description: Mouse monoclonal MATR3 antibody
    MATR3 antibody
    10R-10395 100 ug
    EUR 435
    Description: Mouse monoclonal MATR3 antibody
    MATR3 Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
    MATR3 Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
    MATR3 Antibody
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
    MATR3 Conjugated Antibody
    C36602 100ul
    EUR 397
    anti- MATR3 antibody
    FNab05030 100µg
    EUR 548.75
    • Immunogen: matrin 3
    • Uniprot ID: P43243
    • Gene ID: 9782
    • Research Area: Neuroscience
    Description: Antibody raised against MATR3
    Anti-MATR3 antibody
    PAab05030 100 ug
    EUR 386
    Anti-MATR3 antibody
    STJ117820 100 µl
    EUR 277
    Description: This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X.
    Anti-MATR3 antibody
    STJ192931 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to MATR3
    Matr3/ Rat Matr3 ELISA Kit
    ELI-15737r 96 Tests
    EUR 886
    MATR3 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    MATR3 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    MATR3 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Matrin 3 (MATR3) Antibody
    abx018181-100ug 100 ug
    EUR 342
    • Shipped within 5-10 working days.
    Matrin 3 (MATR3) Antibody
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Matrin 3 (MATR3) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Matrin 3 (MATR3) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Matrin 3 (MATR3) Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Matrin 3 (MATR3) Antibody
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Matrin 3 (MATR3) Antibody
    abx235030-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    MATR3 cloning plasmid
    CSB-CL013525HU-10ug 10ug
    EUR 558
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2544
    • Sequence: atgtccaagtcattccagcagtcatctctcagtagggactcacagggtcatgggcgtgacctgtctgcggcaggaataggccttcttgctgctgctacccagtctttaagtatgccagcatctcttggaaggatgaaccagggtactgcacgccttgctagtttaatgaatcttg
    • Show more
    Description: A cloning plasmid for the MATR3 gene.
    PVT13174 2 ug
    EUR 391
    EF010852 96 Tests
    EUR 689
    Rat MATR3 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human MATR3 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse MATR3 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human Matrin 3 (MATR3) Protein
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Matr3 ORF Vector (Rat) (pORF)
    ORF070324 1.0 ug DNA
    EUR 506
    MATR3 ORF Vector (Human) (pORF)
    ORF006294 1.0 ug DNA
    EUR 95
    Matr3 ORF Vector (Mouse) (pORF)
    ORF049866 1.0 ug DNA
    EUR 506
    MATR3 ELISA Kit (Human) (OKCD01966)
    OKCD01966 96 Wells
    EUR 831
    Description: Description of target: May play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. In association with the SFPQ-NONO heteromer may play a role in nuclear retention of defective RNAs.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL
    Human Matrin-3(MATR3) ELISA kit
    CSB-EL013525HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Matrin-3 (MATR3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Matrin-3(MATR3) ELISA kit
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Matrin-3(MATR3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human Matrin 3 (MATR3) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Matrin- 3, MATR3 ELISA KIT
    ELI-15736h 96 Tests
    EUR 824
    Mouse Matrin- 3, Matr3 ELISA KIT
    ELI-19577m 96 Tests
    EUR 865
    Rat Matrin 3 (MATR3) ELISA Kit
    abx391583-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Matrin 3 (MATR3) CLIA Kit
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Mouse Matrin 3 (MATR3) ELISA Kit
    abx389823-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Matr3 sgRNA CRISPR Lentivector set (Rat)
    K6863001 3 x 1.0 ug
    EUR 339
    MATR3 sgRNA CRISPR Lentivector set (Human)
    K1273601 3 x 1.0 ug
    EUR 339
    MATR3 sgRNA CRISPR Lentivector set (Human)
    K2822501 3 x 1.0 ug
    EUR 339
    Matr3 sgRNA CRISPR Lentivector set (Mouse)
    K4726501 3 x 1.0 ug
    EUR 339
    Human Matrin 3(MATR3)ELISA Kit
    QY-E04807 96T
    EUR 361
    Human Matrin 3 (MATR3) ELISA Kit
    SEH678Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.
    Human Matrin 3 (MATR3) ELISA Kit
    SEH678Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.
    Human Matrin 3 (MATR3) ELISA Kit
    SEH678Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.
    Human Matrin 3 (MATR3) ELISA Kit
    SEH678Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.
    Human Matrin 3 (MATR3) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Matrin 3 elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Matrin 3 (MATR3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    ELISA kit for Human MATR3 (Matrin 3)
    ELK4592 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrin 3 (MATR3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrin 3 (MATR3).
    • Show more
    Description: A sandwich ELISA kit for detection of Matrin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Rat Matrin-3 (MATR3)
    KTE100657-48T 48T
    EUR 332
    • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Rat Matrin-3 (MATR3)
    KTE100657-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Rat Matrin-3 (MATR3)
    KTE100657-96T 96T
    EUR 539
    • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Matr3 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6863002 1.0 ug DNA
    EUR 154
    Matr3 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6863003 1.0 ug DNA
    EUR 154
    Matr3 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6863004 1.0 ug DNA
    EUR 154
    MATR3 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1273602 1.0 ug DNA
    EUR 154
    MATR3 sgRNA CRISPR Lentivector (Human) (Target 2)
    K1273603 1.0 ug DNA
    EUR 154
    MATR3 sgRNA CRISPR Lentivector (Human) (Target 3)
    K1273604 1.0 ug DNA
    EUR 154
    MATR3 sgRNA CRISPR Lentivector (Human) (Target 1)
    K2822502 1.0 ug DNA
    EUR 154
    MATR3 sgRNA CRISPR Lentivector (Human) (Target 2)
    K2822503 1.0 ug DNA
    EUR 154
    MATR3 sgRNA CRISPR Lentivector (Human) (Target 3)
    K2822504 1.0 ug DNA
    EUR 154
    ELISA kit for Mouse Matrin-3 (MATR3)
    KTE71110-48T 48T
    EUR 332
    • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Matrin-3 (MATR3)
    KTE71110-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Matrin-3 (MATR3)
    KTE71110-96T 96T
    EUR 539
    • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Matrin-3 (MATR3)
    KTE61708-48T 48T
    EUR 332
    • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Matrin-3 (MATR3)
    KTE61708-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Matrin-3 (MATR3)
    KTE61708-96T 96T
    EUR 539
    • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4726502 1.0 ug DNA
    EUR 154
    Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4726503 1.0 ug DNA
    EUR 154
    Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4726504 1.0 ug DNA
    EUR 154
    MATR3 Protein Vector (Human) (pPB-C-His)
    PV025173 500 ng
    EUR 329
    MATR3 Protein Vector (Human) (pPB-N-His)
    PV025174 500 ng
    EUR 329
    MATR3 Protein Vector (Human) (pPM-C-HA)
    PV025175 500 ng
    EUR 329
    MATR3 Protein Vector (Human) (pPM-C-His)
    PV025176 500 ng
    EUR 329
    MATR3 Protein Vector (Rat) (pPB-C-His)
    PV281294 500 ng
    EUR 1166
    MATR3 Protein Vector (Rat) (pPB-N-His)
    PV281295 500 ng
    EUR 1166
    MATR3 Protein Vector (Rat) (pPM-C-HA)
    PV281296 500 ng
    EUR 1166
    MATR3 Protein Vector (Rat) (pPM-C-His)
    PV281297 500 ng
    EUR 1166
    MATR3 Protein Vector (Mouse) (pPB-C-His)
    PV199462 500 ng
    EUR 1065
    MATR3 Protein Vector (Mouse) (pPB-N-His)
    PV199463 500 ng
    EUR 1065
    MATR3 Protein Vector (Mouse) (pPM-C-HA)
    PV199464 500 ng
    EUR 1065
    MATR3 Protein Vector (Mouse) (pPM-C-His)
    PV199465 500 ng
    EUR 1065
    Matr3 3'UTR Luciferase Stable Cell Line
    TU112946 1.0 ml Ask for price
    Matr3 3'UTR GFP Stable Cell Line
    TU162946 1.0 ml Ask for price
    Matr3 3'UTR Luciferase Stable Cell Line
    TU212912 1.0 ml Ask for price
    Matr3 3'UTR GFP Stable Cell Line
    TU262912 1.0 ml Ask for price
    MATR3 3'UTR GFP Stable Cell Line
    TU063055 1.0 ml
    EUR 1521
    MATR3 3'UTR Luciferase Stable Cell Line
    TU013055 1.0 ml
    EUR 1521
    Matr3 ELISA Kit| Rat Matrin-3 ELISA Kit
    EF018941 96 Tests
    EUR 689
    Matr3 ELISA Kit| Mouse Matrin-3 ELISA Kit
    EF015458 96 Tests
    EUR 689

    MATR3 Rabbit Polyclonal Antibody