MATR3 Rabbit Polyclonal Antibody

MATR3 Rabbit Polyclonal Antibody

Contact Us Below To Order :

MATR3 Polyclonal Antibody
ABP59230-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MATR3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MATR3 from Human. This MATR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATR3 protein
MATR3 Polyclonal Antibody
ABP59230-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MATR3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MATR3 from Human. This MATR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATR3 protein
Human Matrin 3 (MATR3) ELISA Kit
DLR-MATR3-Hu-48T 48T
EUR 517
  • Should the Human Matrin 3 (MATR3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrin 3 (MATR3) in samples from tissue homogenates or other biological fluids.
Human Matrin 3 (MATR3) ELISA Kit
DLR-MATR3-Hu-96T 96T
EUR 673
  • Should the Human Matrin 3 (MATR3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrin 3 (MATR3) in samples from tissue homogenates or other biological fluids.
Human Matrin 3 (MATR3) ELISA Kit
RD-MATR3-Hu-48Tests 48 Tests
EUR 521
Human Matrin 3 (MATR3) ELISA Kit
RD-MATR3-Hu-96Tests 96 Tests
EUR 723
Human Matrin 3 (MATR3) ELISA Kit
RDR-MATR3-Hu-48Tests 48 Tests
EUR 544
Human Matrin 3 (MATR3) ELISA Kit
RDR-MATR3-Hu-96Tests 96 Tests
EUR 756
MATR3 Rabbit pAb
A5905-100ul 100 ul
EUR 308
MATR3 Rabbit pAb
A5905-200ul 200 ul
EUR 459
MATR3 Rabbit pAb
A5905-20ul 20 ul
EUR 183
MATR3 Rabbit pAb
A5905-50ul 50 ul
EUR 223
MATR3 Antibody
36602-100ul 100ul
EUR 252
MATR3 antibody
10R-10395 100 ug
EUR 435
Description: Mouse monoclonal MATR3 antibody
MATR3 antibody
10R-1442 50 ug
EUR 242
Description: Mouse monoclonal MATR3 antibody
MATR3 antibody
70R-18424 50 ul
EUR 435
Description: Rabbit polyclonal MATR3 antibody
MATR3 Antibody
1-CSB-PA013525GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
MATR3 Antibody
1-CSB-PA272764
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
MATR3 Antibody
1-CSB-PA125471
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
Matr3/ Rat Matr3 ELISA Kit
ELI-15737r 96 Tests
EUR 886
MATR3 Conjugated Antibody
C36602 100ul
EUR 397
anti- MATR3 antibody
FNab05030 100µg
EUR 548.75
  • Immunogen: matrin 3
  • Uniprot ID: P43243
  • Gene ID: 9782
  • Research Area: Neuroscience
Description: Antibody raised against MATR3
Anti-MATR3 antibody
PAab05030 100 ug
EUR 386
Anti-MATR3 antibody
STJ117820 100 µl
EUR 277
Description: This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X.
Anti-MATR3 antibody
STJ192931 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MATR3
MATR3 siRNA
20-abx903173
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MATR3 siRNA
20-abx923628
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MATR3 siRNA
20-abx923629
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Matrin 3 (MATR3) Antibody
20-abx113617
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Matrin 3 (MATR3) Antibody
abx018181-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.
Matrin 3 (MATR3) Antibody
20-abx173467
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Matrin 3 (MATR3) Antibody
20-abx177463
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Matrin 3 (MATR3) Antibody
abx235030-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Matrin 3 (MATR3) Antibody
20-abx213465
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Matrin 3 (MATR3) Antibody
20-abx213466
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
MATR3 cloning plasmid
CSB-CL013525HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2544
  • Sequence: atgtccaagtcattccagcagtcatctctcagtagggactcacagggtcatgggcgtgacctgtctgcggcaggaataggccttcttgctgctgctacccagtctttaagtatgccagcatctcttggaaggatgaaccagggtactgcacgccttgctagtttaatgaatcttg
  • Show more
Description: A cloning plasmid for the MATR3 gene.
pCMV-SPORT6-MATR3
PVT13174 2 ug
EUR 391
Rat MATR3 shRNA Plasmid
20-abx985315
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MATR3 ELISA KIT|Human
EF010852 96 Tests
EUR 689
Human MATR3 shRNA Plasmid
20-abx956544
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse MATR3 shRNA Plasmid
20-abx971445
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human Matrin 3 (MATR3) Protein
20-abx654280
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
MATR3 ORF Vector (Human) (pORF)
ORF006294 1.0 ug DNA
EUR 95
Matr3 ORF Vector (Mouse) (pORF)
ORF049866 1.0 ug DNA
EUR 506
Matr3 ORF Vector (Rat) (pORF)
ORF070324 1.0 ug DNA
EUR 506
Mouse Matrin- 3, Matr3 ELISA KIT
ELI-19577m 96 Tests
EUR 865
Human Matrin- 3, MATR3 ELISA KIT
ELI-15736h 96 Tests
EUR 824
Human Matrin 3 (MATR3) ELISA Kit
20-abx152280
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Matrin 3 (MATR3) CLIA Kit
20-abx495516
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Matrin 3 (MATR3) ELISA Kit
abx389823-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Matrin 3 (MATR3) ELISA Kit
abx391583-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
MATR3 sgRNA CRISPR Lentivector set (Human)
K1273601 3 x 1.0 ug
EUR 339
MATR3 sgRNA CRISPR Lentivector set (Human)
K2822501 3 x 1.0 ug
EUR 339
Matr3 sgRNA CRISPR Lentivector set (Mouse)
K4726501 3 x 1.0 ug
EUR 339
Human Matrin-3(MATR3) ELISA kit
CSB-EL013525HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrin-3 (MATR3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Matrin-3(MATR3) ELISA kit
1-CSB-EL013525HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrin-3(MATR3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Matr3 sgRNA CRISPR Lentivector set (Rat)
K6863001 3 x 1.0 ug
EUR 339
Human Matrin 3(MATR3)ELISA Kit
QY-E04807 96T
EUR 361
Human Matrin 3 (MATR3) ELISA Kit
SEH678Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.
Human Matrin 3 (MATR3) ELISA Kit
SEH678Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.
Human Matrin 3 (MATR3) ELISA Kit
SEH678Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.
Human Matrin 3 (MATR3) ELISA Kit
SEH678Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.
Human Matrin 3 (MATR3) ELISA Kit
4-SEH678Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Matrin 3 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Matrin 3 (MATR3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
ELISA kit for Human MATR3 (Matrin 3)
ELK4592 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrin 3 (MATR3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrin 3 (MATR3).
  • Show more
Description: A sandwich ELISA kit for detection of Matrin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
MATR3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1273602 1.0 ug DNA
EUR 154
MATR3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1273603 1.0 ug DNA
EUR 154
MATR3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1273604 1.0 ug DNA
EUR 154
MATR3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2822502 1.0 ug DNA
EUR 154
MATR3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2822503 1.0 ug DNA
EUR 154
MATR3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2822504 1.0 ug DNA
EUR 154
Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4726502 1.0 ug DNA
EUR 154
Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4726503 1.0 ug DNA
EUR 154
Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4726504 1.0 ug DNA
EUR 154
ELISA kit for Rat Matrin-3 (MATR3)
KTE100657-48T 48T
EUR 332
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Matrin-3 (MATR3)
KTE100657-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Matrin-3 (MATR3)
KTE100657-96T 96T
EUR 539
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Matr3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6863002 1.0 ug DNA
EUR 154
Matr3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6863003 1.0 ug DNA
EUR 154
Matr3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6863004 1.0 ug DNA
EUR 154
ELISA kit for Human Matrin-3 (MATR3)
KTE61708-48T 48T
EUR 332
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrin-3 (MATR3)
KTE61708-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Matrin-3 (MATR3)
KTE61708-96T 96T
EUR 539
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Matrin-3 (MATR3)
KTE71110-48T 48T
EUR 332
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Matrin-3 (MATR3)
KTE71110-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Matrin-3 (MATR3)
KTE71110-96T 96T
EUR 539
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
MATR3 Protein Vector (Rat) (pPB-C-His)
PV281294 500 ng
EUR 1166
MATR3 Protein Vector (Rat) (pPB-N-His)
PV281295 500 ng
EUR 1166
MATR3 Protein Vector (Rat) (pPM-C-HA)
PV281296 500 ng
EUR 1166
MATR3 Protein Vector (Rat) (pPM-C-His)
PV281297 500 ng
EUR 1166
MATR3 Protein Vector (Human) (pPB-C-His)
PV025173 500 ng
EUR 329
MATR3 Protein Vector (Human) (pPB-N-His)
PV025174 500 ng
EUR 329
MATR3 Protein Vector (Human) (pPM-C-HA)
PV025175 500 ng
EUR 329
MATR3 Protein Vector (Human) (pPM-C-His)
PV025176 500 ng
EUR 329
MATR3 Protein Vector (Mouse) (pPB-C-His)
PV199462 500 ng
EUR 1065
MATR3 Protein Vector (Mouse) (pPB-N-His)
PV199463 500 ng
EUR 1065
MATR3 Protein Vector (Mouse) (pPM-C-HA)
PV199464 500 ng
EUR 1065
MATR3 Protein Vector (Mouse) (pPM-C-His)
PV199465 500 ng
EUR 1065
Matr3 3'UTR GFP Stable Cell Line
TU162946 1.0 ml Ask for price
Matr3 3'UTR Luciferase Stable Cell Line
TU212912 1.0 ml Ask for price
MATR3 3'UTR Luciferase Stable Cell Line
TU013055 1.0 ml
EUR 1521
Matr3 3'UTR Luciferase Stable Cell Line
TU112946 1.0 ml Ask for price
MATR3 3'UTR GFP Stable Cell Line
TU063055 1.0 ml
EUR 1521
Matr3 3'UTR GFP Stable Cell Line
TU262912 1.0 ml Ask for price
Matr3 ELISA Kit| Rat Matrin-3 ELISA Kit
EF018941 96 Tests
EUR 689
Matr3 ELISA Kit| Mouse Matrin-3 ELISA Kit
EF015458 96 Tests
EUR 689
MATR3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV688777 1.0 ug DNA
EUR 1355

MATR3 Rabbit Polyclonal Antibody