DNMBP Rabbit Polyclonal Antibody

DNMBP Rabbit Polyclonal Antibody

Contact Us Below To Order :

DNMBP Polyclonal Antibody
ES11769-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DNMBP. This antibody is tested and validated for WB, ELISA, WB, ELISA
DNMBP Polyclonal Antibody
ES11769-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DNMBP. This antibody is tested and validated for WB, ELISA, WB, ELISA
DNMBP antibody
70R-16902 50 ul
EUR 435
Description: Rabbit polyclonal DNMBP antibody
DNMBP Antibody
1-CSB-PA007081GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DNMBP. Recognizes DNMBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
anti- DNMBP antibody
FNab02481 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IP: 1:500-1:2000
  • Immunogen: dynamin binding protein
  • Uniprot ID: Q6XZF7
  • Gene ID: 23268
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against DNMBP
Anti-DNMBP antibody
PAab02481 100 ug
EUR 355
Anti-DNMBP antibody
STJ192927 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DNMBP
DNMBP siRNA
20-abx914449
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DNMBP siRNA
20-abx914450
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-DNMBP
YF-PA17814 50 ug
EUR 363
Description: Mouse polyclonal to DNMBP
anti-DNMBP
YF-PA17815 100 ug
EUR 403
Description: Rabbit polyclonal to DNMBP
anti-DNMBP
YF-PA27516 100 ul
EUR 403
Description: Rabbit polyclonal to DNMBP
DNMBP cloning plasmid
CSB-CL757862HU-10ug 10ug
EUR 801
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2472
  • Sequence: atgacgctcctctcctcccagtcttcatcactggtggccccttctgggtctgtgtctgccgaaaatccagagcagaggatgctggagaagagagccaaggtcatagaagaacttcttcagacagaaagagactacattcgggatctggaaatgtgtattgagcggatcatggtac
  • Show more
Description: A cloning plasmid for the DNMBP gene.
Anti-DNMBP (1H2)
YF-MA17832 100 ug
EUR 363
Description: Mouse monoclonal to DNMBP
Anti-DNMBP (1H2)
YF-MA17833 200 ul
EUR 363
Description: Mouse monoclonal to DNMBP
Anti-DNMBP (1H2)
YF-MA17834 200 ul
EUR 363
Description: Mouse monoclonal to DNMBP
Anti-DNMBP (3H7)
YF-MA17835 100 ug
EUR 363
Description: Mouse monoclonal to DNMBP
Dynamin Binding Protein (DNMBP) Antibody
20-abx112195
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dynamin Binding Protein (DNMBP) Antibody
abx232481-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
DNMBP ELISA KIT|Human
EF009184 96 Tests
EUR 689
Mouse DNMBP shRNA Plasmid
20-abx977608
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human DNMBP shRNA Plasmid
20-abx958138
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Monoclonal DNMBP Antibody (monoclonal) (M01), Clone: 1H2
AMM03464G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human DNMBP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H2. This antibody is applicable in WB
Monoclonal DNMBP Antibody (monoclonal) (M03), Clone: 3H7
AMM03465G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human DNMBP (monoclonal) (M03). The antibodies are raised in mouse and are from clone 3H7. This antibody is applicable in WB
DNMBP ORF Vector (Human) (pORF)
ORF003221 1.0 ug DNA
EUR 95
Dnmbp ORF Vector (Mouse) (pORF)
ORF043238 1.0 ug DNA
EUR 1572
DNMBP sgRNA CRISPR Lentivector set (Human)
K0622401 3 x 1.0 ug
EUR 339
Dnmbp sgRNA CRISPR Lentivector set (Mouse)
K4704601 3 x 1.0 ug
EUR 339
DNMBP-AS1 ORF Vector (Human) (pORF)
ORF018469 1.0 ug DNA Ask for price
Human Dynamin- binding protein, DNMBP ELISA KIT
ELI-26845h 96 Tests
EUR 824
Human Dynamin Binding Protein (DNMBP) ELISA Kit
abx386956-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Dynamin Binding Protein (DNMBP) ELISA Kit
abx389117-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Dynamin- binding protein, Dnmbp ELISA KIT
ELI-31730m 96 Tests
EUR 865
DNMBP sgRNA CRISPR Lentivector (Human) (Target 1)
K0622402 1.0 ug DNA
EUR 154
DNMBP sgRNA CRISPR Lentivector (Human) (Target 2)
K0622403 1.0 ug DNA
EUR 154
DNMBP sgRNA CRISPR Lentivector (Human) (Target 3)
K0622404 1.0 ug DNA
EUR 154
Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4704602 1.0 ug DNA
EUR 154
Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4704603 1.0 ug DNA
EUR 154
Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4704604 1.0 ug DNA
EUR 154
DNMBP Protein Vector (Mouse) (pPB-C-His)
PV172950 500 ng
EUR 2660
DNMBP Protein Vector (Mouse) (pPB-N-His)
PV172951 500 ng
EUR 2660
DNMBP Protein Vector (Mouse) (pPM-C-HA)
PV172952 500 ng
EUR 2660
DNMBP Protein Vector (Mouse) (pPM-C-His)
PV172953 500 ng
EUR 2660
DNMBP Protein Vector (Human) (pPB-C-His)
PV012881 500 ng
EUR 329
DNMBP Protein Vector (Human) (pPB-N-His)
PV012882 500 ng
EUR 329
DNMBP Protein Vector (Human) (pPM-C-HA)
PV012883 500 ng
EUR 329
DNMBP Protein Vector (Human) (pPM-C-His)
PV012884 500 ng
EUR 329
Dnmbp 3'UTR GFP Stable Cell Line
TU155303 1.0 ml Ask for price
Dnmbp 3'UTR Luciferase Stable Cell Line
TU105303 1.0 ml Ask for price
Dnmbp 3'UTR Luciferase Stable Cell Line
TU203558 1.0 ml Ask for price
Dnmbp 3'UTR GFP Stable Cell Line
TU253558 1.0 ml Ask for price
DNMBP 3'UTR GFP Stable Cell Line
TU056218 1.0 ml
EUR 2333
DNMBP 3'UTR Luciferase Stable Cell Line
TU006218 1.0 ml
EUR 2333
Dnmbp ELISA Kit| Mouse Dynamin-binding protein ELISA Kit
EF014747 96 Tests
EUR 689
DNMBP-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV723287 1.0 ug DNA Ask for price
DNMBP-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723291 1.0 ug DNA Ask for price
DNMBP-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV723292 1.0 ug DNA Ask for price
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

DNMBP Rabbit Polyclonal Antibody