DDX5 Rabbit Polyclonal Antibody

DDX5 Rabbit Polyclonal Antibody

Contact Us Below To Order :

DDX5 Polyclonal Antibody

ABP58346-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DDX5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DDX5 from Human. This DDX5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDX5 protein

DDX5 Polyclonal Antibody

ES11761-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DDX5. This antibody is tested and validated for WB, ELISA, WB, ELISA

DDX5 Polyclonal Antibody

ES11761-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DDX5. This antibody is tested and validated for WB, ELISA, WB, ELISA

DDX5 Rabbit mAb

A11339-100ul 100 ul
EUR 410

DDX5 Rabbit mAb

A11339-200ul 200 ul
EUR 571

DDX5 Rabbit mAb

A11339-20ul 20 ul
EUR 221

DDX5 Rabbit mAb

A11339-50ul 50 ul
EUR 287

DDX5 Rabbit pAb

A13294-100ul 100 ul
EUR 308

DDX5 Rabbit pAb

A13294-200ul 200 ul
EUR 459

DDX5 Rabbit pAb

A13294-20ul 20 ul
EUR 183

DDX5 Rabbit pAb

A13294-50ul 50 ul
EUR 223

DDX5 Rabbit pAb

A5296-100ul 100 ul
EUR 308

DDX5 Rabbit pAb

A5296-200ul 200 ul
EUR 459

DDX5 Rabbit pAb

A5296-20ul 20 ul
EUR 183

DDX5 Rabbit pAb

A5296-50ul 50 ul
EUR 223

Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit

DLR-DDX5-Hu-48T 48T
EUR 554
  • Should the Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DEAD Box Polypeptide 5 (DDX5) in samples from tissue homogenates or other biological fluids.

Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit

DLR-DDX5-Hu-96T 96T
EUR 725
  • Should the Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DEAD Box Polypeptide 5 (DDX5) in samples from tissue homogenates or other biological fluids.

Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit

RDR-DDX5-Hu-48Tests 48 Tests
EUR 589

Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit

RDR-DDX5-Hu-96Tests 96 Tests
EUR 820

Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit

RD-DDX5-Hu-48Tests 48 Tests
EUR 563

Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit

RD-DDX5-Hu-96Tests 96 Tests
EUR 783

DDX5 antibody

70R-21510 50 ul
EUR 435
Description: Rabbit polyclonal DDX5 antibody

DDX5 antibody

70R-1382 100 ug
EUR 377
Description: Rabbit polyclonal DDX5 antibody

DDX5 antibody

70R-1398 100 ug
EUR 377
Description: Rabbit polyclonal DDX5 antibody

DDX5 Antibody

32750-100ul 100ul
EUR 252

DDX5 antibody

10R-1420 100 ug
EUR 512
Description: Mouse monoclonal DDX5 antibody

DDX5 Antibody

49625-100ul 100ul
EUR 333

DDX5 Antibody

49625-50ul 50ul
EUR 239

DDX5 Antibody

1-CSB-PA003685
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DDX5. Recognizes DDX5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

DDX5 Antibody

DF7258 200ul
EUR 304
Description: DDX5 Antibody detects endogenous levels of total DDX5.

DDX5 Antibody

DF7539 200ul
EUR 304
Description: DDX5 Antibody detects endogenous levels of total DDX5.

DDX5 Antibody

1-CSB-PA006630ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DDX5. Recognizes DDX5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

DDX5 Antibody

1-CSB-PA006630GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DDX5. Recognizes DDX5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

DDX5 antibody

70R-33555 100 ug
EUR 327
Description: Rabbit polyclonal DDX5 antibody

DDX5 Antibody

ABD7258 100 ug
EUR 438

DDX5 Antibody

ABD7539 100 ug
EUR 438

Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E04P0780-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E04P0780-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E04P0780-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-DDX5 Antibody

A00670 100ug/vial
EUR 334

DDX5 antibody (Tyr593)

70R-33554 100 ug
EUR 327
Description: Rabbit polyclonal DDX5 antibody (Tyr593)

DDX5 (pY593) Antibody

20-abx133132
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

DDX5 Conjugated Antibody

C49625 100ul
EUR 397

DDX5 Conjugated Antibody

C32750 100ul
EUR 397

DDX5,p68 Antibody

abx232312-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-DDX5 Antibody

PA1964 100ug/vial
EUR 334

Anti-DDX5 antibody

STJ27249 100 µl
EUR 277
Description: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants.

Anti-DDX5 antibody

STJ115258 100 µl
EUR 277
Description: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants.

Anti-DDX5 antibody

STJ192919 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DDX5

DDX5 siRNA

20-abx913835
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DDX5

YF-PA11326 50 ug
EUR 363
Description: Mouse polyclonal to DDX5

Phospho-DDX5 (Y593) Antibody

1-CSB-PA007714
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-DDX5 (Y593). Recognizes Phospho-DDX5 (Y593) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

DDX5 recombinant monoclonal antibody

A5921 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human DDX5 for WB, IHC, IF,ELISA

anti- DDX5,p68 antibody

FNab02312 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: DEAD(Asp-Glu-Ala-Asp) box polypeptide 5
  • Uniprot ID: P17844
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against DDX5,p68

Anti-DDX5 Monoclonal Antibody

M00670 100ug
EUR 397
Description: Rabbit Monoclonal DDX5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-DDX5,p68 antibody

PAab02312 100 ug
EUR 355

Human Probable ATP-dependent RNA helicase DDX5 (DDX5)

1-CSB-EP006630HU
  • EUR 437.00
  • EUR 238.00
  • EUR 1544.00
  • EUR 653.00
  • EUR 1029.00
  • EUR 296.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 74.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Probable ATP-dependent RNA helicase DDX5(DDX5) expressed in E.coli

DDX5 Blocking Peptide

33R-7933 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX5 antibody, catalog no. 70R-1398

DDX5 Blocking Peptide

33R-8427 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX5 antibody, catalog no. 70R-1382

DDX5 Blocking Peptide

DF7258-BP 1mg
EUR 195

DDX5 Blocking Peptide

DF7539-BP 1mg
EUR 195

DDX5 Blocking Peptide

20-abx162388
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

DDX5 cloning plasmid

CSB-CL006630HU-10ug 10ug
EUR 626
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1845
  • Sequence: atgtcgggttattcgagtgaccgagaccgcggccgggaccgagggtttggtgcacctcgatttggaggaagtagggcagggcccttatctggaaagaagtttggaaaccctggggagaaattagttaaaaagaagtggaatcttgatgagctgcctaaatttgagaagaattttt
  • Show more
Description: A cloning plasmid for the DDX5 gene.

Recombinant human DDX5

P1933 100ug Ask for price
  • Uniprot ID: P17844
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human DDX5

Rat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E02P0780-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E02P0780-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E02P0780-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E03P0780-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E03P0780-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E03P0780-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E01P0780-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E01P0780-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E01P0780-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E06P0780-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E06P0780-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E06P0780-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E08P0780-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E08P0780-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E08P0780-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E07P0780-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E07P0780-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

E07P0780-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

DDX5 Rabbit Polyclonal Antibody