DDX5 Rabbit Polyclonal Antibody

DDX5 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    DDX5 Polyclonal Antibody

    ABP58346-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human DDX5 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of DDX5 from Human. This DDX5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDX5 protein

    DDX5 Polyclonal Antibody

    ES11761-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against DDX5. This antibody is tested and validated for WB, ELISA, WB, ELISA

    DDX5 Polyclonal Antibody

    ES11761-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against DDX5. This antibody is tested and validated for WB, ELISA, WB, ELISA

    DDX5 Rabbit mAb

    A11339-100ul 100 ul
    EUR 410

    DDX5 Rabbit mAb

    A11339-200ul 200 ul
    EUR 571

    DDX5 Rabbit mAb

    A11339-20ul 20 ul
    EUR 221

    DDX5 Rabbit mAb

    A11339-50ul 50 ul
    EUR 287

    DDX5 Rabbit pAb

    A13294-100ul 100 ul
    EUR 308

    DDX5 Rabbit pAb

    A13294-200ul 200 ul
    EUR 459

    DDX5 Rabbit pAb

    A13294-20ul 20 ul
    EUR 183

    DDX5 Rabbit pAb

    A13294-50ul 50 ul
    EUR 223

    DDX5 Rabbit pAb

    A5296-100ul 100 ul
    EUR 308

    DDX5 Rabbit pAb

    A5296-200ul 200 ul
    EUR 459

    DDX5 Rabbit pAb

    A5296-20ul 20 ul
    EUR 183

    DDX5 Rabbit pAb

    A5296-50ul 50 ul
    EUR 223

    Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit

    DLR-DDX5-Hu-48T 48T
    EUR 554
    • Should the Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human DEAD Box Polypeptide 5 (DDX5) in samples from tissue homogenates or other biological fluids.

    Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit

    DLR-DDX5-Hu-96T 96T
    EUR 725
    • Should the Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human DEAD Box Polypeptide 5 (DDX5) in samples from tissue homogenates or other biological fluids.

    Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit

    RDR-DDX5-Hu-48Tests 48 Tests
    EUR 589

    Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit

    RDR-DDX5-Hu-96Tests 96 Tests
    EUR 820

    Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit

    RD-DDX5-Hu-48Tests 48 Tests
    EUR 563

    Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit

    RD-DDX5-Hu-96Tests 96 Tests
    EUR 783

    DDX5 antibody

    70R-21510 50 ul
    EUR 435
    Description: Rabbit polyclonal DDX5 antibody

    DDX5 antibody

    70R-1382 100 ug
    EUR 377
    Description: Rabbit polyclonal DDX5 antibody

    DDX5 antibody

    70R-1398 100 ug
    EUR 377
    Description: Rabbit polyclonal DDX5 antibody

    DDX5 Antibody

    32750-100ul 100ul
    EUR 252

    DDX5 antibody

    10R-1420 100 ug
    EUR 512
    Description: Mouse monoclonal DDX5 antibody

    DDX5 Antibody

    49625-100ul 100ul
    EUR 333

    DDX5 Antibody

    49625-50ul 50ul
    EUR 239

    DDX5 Antibody

    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against DDX5. Recognizes DDX5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

    DDX5 Antibody

    DF7258 200ul
    EUR 304
    Description: DDX5 Antibody detects endogenous levels of total DDX5.

    DDX5 Antibody

    DF7539 200ul
    EUR 304
    Description: DDX5 Antibody detects endogenous levels of total DDX5.

    DDX5 Antibody

    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against DDX5. Recognizes DDX5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

    DDX5 Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against DDX5. Recognizes DDX5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

    DDX5 antibody

    70R-33555 100 ug
    EUR 327
    Description: Rabbit polyclonal DDX5 antibody

    DDX5 Antibody

    ABD7258 100 ug
    EUR 438

    DDX5 Antibody

    ABD7539 100 ug
    EUR 438

    Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E04P0780-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E04P0780-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E04P0780-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Anti-DDX5 Antibody

    A00670 100ug/vial
    EUR 334

    DDX5 antibody (Tyr593)

    70R-33554 100 ug
    EUR 327
    Description: Rabbit polyclonal DDX5 antibody (Tyr593)

    DDX5 (pY593) Antibody

    • EUR 314.00
    • EUR 467.00
    • EUR 203.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    DDX5 Conjugated Antibody

    C49625 100ul
    EUR 397

    DDX5 Conjugated Antibody

    C32750 100ul
    EUR 397

    DDX5,p68 Antibody

    abx232312-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Anti-DDX5 Antibody

    PA1964 100ug/vial
    EUR 334

    Anti-DDX5 antibody

    STJ27249 100 µl
    EUR 277
    Description: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants.

    Anti-DDX5 antibody

    STJ115258 100 µl
    EUR 277
    Description: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants.

    Anti-DDX5 antibody

    STJ192919 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to DDX5

    DDX5 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.


    YF-PA11326 50 ug
    EUR 363
    Description: Mouse polyclonal to DDX5

    Phospho-DDX5 (Y593) Antibody

    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against Phospho-DDX5 (Y593). Recognizes Phospho-DDX5 (Y593) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

    DDX5 recombinant monoclonal antibody

    A5921 100ul X 3
    EUR 595
    • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
    • Show more
    Description: A recombinant monoclonal antibody from rabbit against human DDX5 for WB, IHC, IF,ELISA

    anti- DDX5,p68 antibody

    FNab02312 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:1000
    • IHC: 1:20-1:200
    • Immunogen: DEAD(Asp-Glu-Ala-Asp) box polypeptide 5
    • Uniprot ID: P17844
    • Research Area: Neuroscience, Metabolism, Developmental biology
    Description: Antibody raised against DDX5,p68

    Anti-DDX5 Monoclonal Antibody

    M00670 100ug
    EUR 397
    Description: Rabbit Monoclonal DDX5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

    Anti-DDX5,p68 antibody

    PAab02312 100 ug
    EUR 355

    Human Probable ATP-dependent RNA helicase DDX5 (DDX5)

    • EUR 437.00
    • EUR 238.00
    • EUR 1544.00
    • EUR 653.00
    • EUR 1029.00
    • EUR 296.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 74.1 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Probable ATP-dependent RNA helicase DDX5(DDX5) expressed in E.coli

    DDX5 Blocking Peptide

    33R-7933 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX5 antibody, catalog no. 70R-1398

    DDX5 Blocking Peptide

    33R-8427 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX5 antibody, catalog no. 70R-1382

    DDX5 Blocking Peptide

    DF7258-BP 1mg
    EUR 195

    DDX5 Blocking Peptide

    DF7539-BP 1mg
    EUR 195

    DDX5 Blocking Peptide

    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    DDX5 cloning plasmid

    CSB-CL006630HU-10ug 10ug
    EUR 626
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1845
    • Sequence: atgtcgggttattcgagtgaccgagaccgcggccgggaccgagggtttggtgcacctcgatttggaggaagtagggcagggcccttatctggaaagaagtttggaaaccctggggagaaattagttaaaaagaagtggaatcttgatgagctgcctaaatttgagaagaattttt
    • Show more
    Description: A cloning plasmid for the DDX5 gene.

    Recombinant human DDX5

    P1933 100ug Ask for price
    • Uniprot ID: P17844
    • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
    Description: Recombinant protein for human DDX5

    Rat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E02P0780-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E02P0780-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E02P0780-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E03P0780-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E03P0780-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E03P0780-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E01P0780-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E01P0780-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E01P0780-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E06P0780-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E06P0780-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E06P0780-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E08P0780-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E08P0780-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E08P0780-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E07P0780-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E07P0780-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit

    E07P0780-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    DDX5 Rabbit Polyclonal Antibody