ACTN1 Rabbit Polyclonal Antibody

ACTN1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    ACTN1 Polyclonal Antibody
    ABP57700-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human ACTN1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ACTN1 from Human. This ACTN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTN1 protein
    ACTN1 Rabbit pAb
    A1160-100ul 100 ul
    EUR 308
    ACTN1 Rabbit pAb
    A1160-200ul 200 ul
    EUR 459
    ACTN1 Rabbit pAb
    A1160-20ul 20 ul
    EUR 183
    ACTN1 Rabbit pAb
    A1160-50ul 50 ul
    EUR 223
    ACTN1 antibody
    70R-32268 100 ug
    EUR 327
    Description: Rabbit polyclonal ACTN1 antibody
    ACTN1 Antibody
    ABD6294 100 ug
    EUR 438
    ACTN1 Antibody
    34156-100ul 100ul
    EUR 252
    ACTN1 Antibody
    34156-50ul 50ul
    EUR 187
    ACTN1 antibody
    10R-11454 50 ul
    EUR 241
    Description: Mouse Monoclonal ACTN1 antibody
    ACTN1 Antibody
    32192-100ul 100ul
    EUR 252
    ACTN1 antibody
    10R-3172 100 ul
    EUR 726
    Description: Mouse monoclonal ACTN1 antibody
    ACTN1 antibody
    70R-15567 50 ul
    EUR 435
    Description: Rabbit polyclonal ACTN1 antibody
    ACTN1 Antibody
    DF6294 200ul
    EUR 304
    Description: ACTN1 Antibody detects endogenous levels of total ACTN1.
    ACTN1 Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50
    ACTN1 Antibody
    EUR 335
    • Form: liquid
    • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
    • Show more
    Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
    ACTN1 Antibody
    CSB-PA945352-100ul 100ul
    EUR 316
    • Form: liquid
    • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
    • Show more
    Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
    ACTN1 Antibody
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
    ACTN1 Antibody
    • EUR 317.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:1000-1:5000, IF:1:50-1:200
    ACTN1 Antibody
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
    Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500
    ACTN1 Antibody
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
    ACTN1 Conjugated Antibody
    C32192 100ul
    EUR 397
    Anti-ACTN1 antibody
    STJ22500 100 µl
    EUR 277
    Description: Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene.
    Anti-ACTN1 antibody
    STJ192916 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to ACTN1
    Polyclonal ACTN1 (aa596-609) Antibody (internal region)
    APR14794G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ACTN1 (aa596-609) (internal region). This antibody is tested and proven to work in the following applications:
    Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human)
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1)
    ACTN1 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    ACTN1 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    ACTN1 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    ACTN1 protein
    80R-4307 100 ug
    EUR 327
    Description: Purified Recombinant ACTN1 protein (His tagged)
    ACTN1 Antibody, HRP conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    ACTN1 Antibody, FITC conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    ACTN1 Antibody, Biotin conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with APC.
    Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), Biotinylated
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with Biotin.
    Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with Cy3.
    Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with FITC.
    Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with HRP.
    Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with PE.
    ACTN1 Blocking Peptide
    • EUR 258.00
    • EUR 384.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.
    ACTN1 Blocking Peptide
    DF6294-BP 1mg
    EUR 195
    ACTN1 cloning plasmid
    CSB-CL001241HU-10ug 10ug
    EUR 860
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2679
    • Sequence: atggaccattatgattctcagcaaaccaacgattacatgcagccagaagaggactgggaccgggacctgctcctggacccggcctgggagaagcagcagagaaagacattcacggcatggtgtaactcccacctccggaaggcggggacacagatcgagaacatcgaagaggact
    • Show more
    Description: A cloning plasmid for the ACTN1 gene.
    Anti-ACTN1 (3F1)
    YF-MA20269 200 ul
    EUR 363
    Description: Mouse monoclonal to ACTN1
    Actinin Alpha 1 (ACTN1) Antibody
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Actinin Alpha 1 (ACTN1) Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Alpha Actinin 1 (ACTN1) Antibody
    abx122374-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Alpha Actinin 1 (ACTN1) Antibody
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Alpha Actinin 1 (ACTN1) Antibody
    • EUR 356.00
    • EUR 537.00
    • EUR 217.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    Actinin Alpha 1 (ACTN1) Antibody
    • EUR 272.00
    • EUR 230.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    ACTN1 / 2 / 3 / 4 Antibody
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    ACTN1 / 2 / 3 / 4 Antibody
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    Alpha Actinin 1 (ACTN1) Antibody
    • EUR 356.00
    • EUR 537.00
    • EUR 217.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    Alpha Actinin 1 (ACTN1) Antibody
    • EUR 314.00
    • EUR 98.00
    • EUR 398.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 200 ug
    • 300 µg
    • Shipped within 5-10 working days.
    ACTN1 / 2 / 3 / 4 Antibody
    • EUR 314.00
    • EUR 98.00
    • EUR 398.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 200 ug
    • 300 µg
    • Shipped within 5-10 working days.
    Actinin Alpha 1 (ACTN1) Antibody
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    ACTN1 / ACTN2 / ACTN3 / ACTN4 Antibody
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Actinin Alpha 1 (ACTN1) Antibody
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    ACTN1 / ACTN2 / ACTN3 / ACTN4 Antibody
    abx332562-100ul 100 ul
    EUR 425
    • Shipped within 5-10 working days.
    Actinin Alpha 1 (ACTN1) Antibody
    abx332763-100ul 100 ul
    EUR 425
    • Shipped within 5-10 working days.
    Alpha Actinin 1 (ACTN1) Antibody
    abx431046-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    Alpha Actinin 1 (ACTN1) Antibody
    abx239833-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    Actinin Alpha 1 (ACTN1) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    ACTN1/2/3/4 antibody
    70R-51785 100 ul
    EUR 244
    Description: Purified Polyclonal ACTN1/2/3/4 antibody
    ACTN1/2/3/4 Antibody
    ABD8633 100 ug
    EUR 438
    ACTN1/2/3/4 Antibody
    45407-100ul 100ul
    EUR 252
    ACTN1/2/3/4 Antibody
    45407-50ul 50ul
    EUR 187
    ACTN1/2/3/4 Antibody
    47879-100ul 100ul
    EUR 252
    ACTN1/2/3/4 Antibody
    DF8633 200ul
    EUR 304
    Description: ACTN1/2/3/4 Antibody detects endogenous levels of total ACTN1/2/3/4.
    ACTN1/ACTN2/ACTN3/ACTN4 Antibody
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against ACTN1/ACTN2/ACTN3/ACTN4. Recognizes ACTN1/ACTN2/ACTN3/ACTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
    ACTN1/ACTN2/ACTN3/ACTN4 Antibody
    EUR 335
    • Form: liquid
    • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
    • Show more
    Description: A polyclonal antibody against ACTN1/ACTN2/ACTN3/ACTN4. Recognizes ACTN1/ACTN2/ACTN3/ACTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
    ACTN1/ACTN2/ACTN3/ACTN4 Antibody
    CSB-PA096347-100ul 100ul
    EUR 316
    • Form: liquid
    • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
    • Show more
    Description: A polyclonal antibody against ACTN1/ACTN2/ACTN3/ACTN4. Recognizes ACTN1/ACTN2/ACTN3/ACTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
    Anti-ACTN1 (aa596-609) antibody
    STJ73407 100 µg
    EUR 359
    Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with APC-Cy7.
    ACTN1/2/3/4 Conjugated Antibody
    C45407 100ul
    EUR 397
    ACTN1/2/3/4 Conjugated Antibody
    C47879 100ul
    EUR 397
    Human Alpha-Actinin-1 (ACTN1) Antibody
    33287-05111 150 ug
    EUR 276

    ACTN1 Rabbit Polyclonal Antibody