STIP1 Rabbit Polyclonal Antibody

STIP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    STIP1 Polyclonal Antibody

    A54796 100 µg
    EUR 570.55
    Description: The best epigenetics products

    STIP1 Polyclonal Antibody

    ABP60539-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human STIP1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of STIP1 from Human. This STIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STIP1 protein

    STIP1 Polyclonal Antibody

    ABP60539-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human STIP1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of STIP1 from Human. This STIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STIP1 protein

    STIP1 Polyclonal Antibody

    ABP60539-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human STIP1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of STIP1 from Human. This STIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STIP1 protein

    StIp1 Polyclonal Antibody

    ES3522-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against StIp1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    StIp1 Polyclonal Antibody

    ES3522-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against StIp1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    STIP1 Polyclonal Antibody

    ES11756-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against STIP1. This antibody is tested and validated for WB, ELISA, WB, ELISA

    STIP1 Polyclonal Antibody

    ES11756-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against STIP1. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit

    DLR-STIP1-Hu-48T 48T
    EUR 517
    • Should the Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Stress Induced Phosphoprotein 1 (STIP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit

    DLR-STIP1-Hu-96T 96T
    EUR 673
    • Should the Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Stress Induced Phosphoprotein 1 (STIP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit

    RD-STIP1-Hu-48Tests 48 Tests
    EUR 521

    Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit

    RD-STIP1-Hu-96Tests 96 Tests
    EUR 723

    Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit

    RDR-STIP1-Hu-48Tests 48 Tests
    EUR 544

    Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit

    RDR-STIP1-Hu-96Tests 96 Tests
    EUR 756

    STIP1 Rabbit pAb

    A14106-100ul 100 ul
    EUR 308

    STIP1 Rabbit pAb

    A14106-200ul 200 ul
    EUR 459

    STIP1 Rabbit pAb

    A14106-20ul 20 ul
    EUR 183

    STIP1 Rabbit pAb

    A14106-50ul 50 ul
    EUR 223

    STIP1 Rabbit pAb

    A1219-100ul 100 ul
    EUR 308

    STIP1 Rabbit pAb

    A1219-200ul 200 ul
    EUR 459

    STIP1 Rabbit pAb

    A1219-20ul 20 ul
    EUR 183

    STIP1 Rabbit pAb

    A1219-50ul 50 ul
    EUR 223

    Polyclonal STIP1 Antibody (Center)

    APR05081G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STIP1 (Center). This antibody is tested and proven to work in the following applications:

    Polyclonal STIP1 Antibody (C-term)

    APR05080G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STIP1 (C-term). This antibody is tested and proven to work in the following applications:

    STIP1 Polyclonal Antibody, Biotin Conjugated

    A54793 100 µg
    EUR 570.55
    Description: Ask the seller for details

    STIP1 Polyclonal Antibody, FITC Conjugated

    A54794 100 µg
    EUR 570.55
    Description: The best epigenetics products

    STIP1 Polyclonal Antibody, HRP Conjugated

    A54795 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    STIP1 antibody

    22582-100ul 100ul
    EUR 390

    STIP1 antibody

    70R-12703 100 ul
    EUR 457
    Description: Affinity purified Rabbit polyclonal STIP1 antibody

    STIP1 antibody

    70R-1288 100 ug
    EUR 377
    Description: Rabbit polyclonal STIP1 antibody

    STIP1 antibody

    70R-1289 100 ug
    EUR 377
    Description: Rabbit polyclonal STIP1 antibody

    STIP1 antibody

    70R-20588 50 ul
    EUR 435
    Description: Rabbit polyclonal STIP1 antibody

    STIP1 Antibody

    32236-100ul 100ul
    EUR 252

    STIP1 Antibody

    49844-100ul 100ul
    EUR 333

    STIP1 Antibody

    49844-50ul 50ul
    EUR 239

    STIP1 Antibody

    DF6351 200ul
    EUR 304
    Description: STIP1 Antibody detects endogenous levels of total STIP1.

    STIP1 Antibody

    1-CSB-PA022831GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    STIP1 Antibody

    1-CSB-PA022831HA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

    StIp1 Antibody

    AF9204 200ul
    EUR 304
    Description: StIp1 Antibody detects endogenous levels of total StIp1.

    StIp1 Antibody

    ABF9204 100 ug
    EUR 438

    STIP1 Antibody

    ABD6351 100 ug
    EUR 438

    Anti-StIp1 Antibody

    A07823 100ul
    EUR 397
    Description: Rabbit Polyclonal Antibody for StIp1 Antibody (ELP2) detection. Tested with WB in Human.

    STIP1 Conjugated Antibody

    C49844 100ul
    EUR 397

    STIP1 Conjugated Antibody

    C32236 100ul
    EUR 397

    anti- STIP1 antibody

    FNab08323 100µg
    EUR 548.75
    • Immunogen: stress-induced-phosphoprotein 1
    • Uniprot ID: P31948
    • Gene ID: 10963
    • Research Area: Cardiovascular
    Description: Antibody raised against STIP1

    Anti-STIP1 antibody

    PAab08323 100 ug
    EUR 386

    Anti-STIP1 Antibody

    PB9896 100ug/vial
    EUR 294

    Anti-STIP1 antibody

    STJ25731 100 µl
    EUR 277

    Anti-STIP1 antibody

    STJ116041 100 µl
    EUR 277

    Anti-STIP1 antibody

    STJ192914 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to STIP1

    Anti-StIp1 antibody

    STJ95824 200 µl
    EUR 197
    Description: Rabbit polyclonal to StIp1.

    STIP1 siRNA

    20-abx905329
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    STIP1 siRNA

    20-abx935450
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    STIP1 siRNA

    20-abx935451
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    anti-STIP1

    YF-PA17333 50 ul
    EUR 363
    Description: Mouse polyclonal to STIP1

    anti-STIP1

    YF-PA17334 50 ug
    EUR 363
    Description: Mouse polyclonal to STIP1

    anti-STIP1

    YF-PA21419 50 ul
    EUR 363
    Description: Mouse polyclonal to STIP1

    anti-STIP1

    YF-PA26731 50 ul
    EUR 334
    Description: Mouse polyclonal to STIP1

    anti-STIP1

    YF-PA25702 50 ul
    EUR 334
    Description: Mouse polyclonal to STIP1

    STIP1 Antibody, HRP conjugated

    1-CSB-PA022831HB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    STIP1 Antibody, FITC conjugated

    1-CSB-PA022831HC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    STIP1 Antibody, Biotin conjugated

    1-CSB-PA022831HD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    STIP1 recombinant monoclonal antibody

    A5499 100ul X 3
    EUR 595
    • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
    • Show more
    Description: A recombinant monoclonal antibody from rabbit against human STIP1 for WB, IF,ELISA

    Anti-STIP1 Monoclonal Antibody

    M02683 100ug
    EUR 397
    Description: Rabbit Monoclonal STIP1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

    STIP1 Blocking Peptide

    33R-10212 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STIP1 antibody, catalog no. 70R-1289

    STIP1 Blocking Peptide

    33R-1327 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LIG1 antibody, catalog no. 70R-5621

    STIP1 Blocking Peptide

    DF6351-BP 1mg
    EUR 195

    STIP1 cloning plasmid

    CSB-CL022831HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1632
    • Sequence: atggagcaggtcaatgagctgaaggagaaaggcaacaaggccctgagcgtgggtaacatcgatgatgccttacagtgctactccgaagctattaagctggatccccacaaccacgtgctgtacagcaaccgttctgctgcctatgccaagaaaggagactaccagaaggcttatg
    • Show more
    Description: A cloning plasmid for the STIP1 gene.

    StIp1 Blocking Peptide

    AF9204-BP 1mg
    EUR 195

    Anti-STIP1 (4B6)

    YF-MA11328 100 ug
    EUR 363
    Description: Mouse monoclonal to STIP1

    Anti-STIP1 (1E3)

    YF-MA11329 100 ug
    EUR 363
    Description: Mouse monoclonal to STIP1

    Anti-STIP1 (3D6)

    YF-MA11695 100 ug
    EUR 363
    Description: Mouse monoclonal to STIP1

    STIP1 Rabbit Polyclonal Antibody