WDFY1 Rabbit Polyclonal Antibody

WDFY1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

WDFY1 Polyclonal Antibody
ABP60912-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human WDFY1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of WDFY1 from Human. This WDFY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WDFY1 protein
WDFY1 Polyclonal Antibody
ES11743-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WDFY1 from . This antibody is tested and validated for WB, ELISA, WB, ELISA
WDFY1 Polyclonal Antibody
ES11743-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WDFY1 from . This antibody is tested and validated for WB, ELISA, WB, ELISA
WDFY1 Antibody
46708-100ul 100ul
EUR 252
WDFY1 Antibody
1-CSB-PA816890LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
WDFY1 antibody
70R-4012 50 ug
EUR 467
Description: Rabbit polyclonal WDFY1 antibody raised against the N terminal of WDFY1
Polyclonal WDFY1 antibody - N-terminal region
AMM08508G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WDFY1 - N-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal FENS1 / WDFY1 Antibody (C-Term)
APR15946G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FENS1 / WDFY1 (C-Term). This antibody is tested and proven to work in the following applications:
WDFY1 Conjugated Antibody
C46708 100ul
EUR 397
WDFY1 Antibody (HRP)
20-abx315463
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
WDFY1 Antibody (FITC)
20-abx315464
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
WDFY1 Antibody (Biotin)
20-abx315465
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-WDFY1 antibody
STJ192901 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to WDFY1
WDFY1 siRNA
20-abx939669
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
WDFY1 Antibody, HRP conjugated
1-CSB-PA816890LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
WDFY1 Antibody, FITC conjugated
1-CSB-PA816890LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
WDFY1 Antibody, Biotin conjugated
1-CSB-PA816890LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-FENS1 / WDFY1 antibody
STJ70535 100 µg
EUR 260
WDFY1 Blocking Peptide
33R-5591 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WDFY1 antibody, catalog no. 70R-4012
WDFY1 cloning plasmid
CSB-CL816890HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1233
  • Sequence: atggcggccgaaatccactccaggccgcagagcagccgcccggtgctgctgagcaagatcgaggggcaccaggacgccgtcacggccgcgctgctcatccccaaggaggacggcgtgatcacggccagcgaggacagaaccatccgggtatggctgaaaagagacagtggtcaat
  • Show more
Description: A cloning plasmid for the WDFY1 gene.
Bovine WDFY1 ELISA KIT
ELI-16956b 96 Tests
EUR 928
Human WDFY1 ELISA KIT
ELI-28737h 96 Tests
EUR 824
Human WDFY1 shRNA Plasmid
20-abx961562
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
WDFY1 Recombinant Protein (Rat)
RP237194 100 ug Ask for price
WDFY1 Recombinant Protein (Human)
RP034543 100 ug Ask for price
WDFY1 Recombinant Protein (Mouse)
RP185174 100 ug Ask for price
WDFY1 Recombinant Protein (Mouse)
RP185177 100 ug Ask for price
Wdfy1 ORF Vector (Mouse) (pORF)
ORF061726 1.0 ug DNA
EUR 506
Wdfy1 ORF Vector (Mouse) (pORF)
ORF061727 1.0 ug DNA
EUR 506
Wdfy1 ORF Vector (Rat) (pORF)
ORF079066 1.0 ug DNA
EUR 506
WDFY1 ORF Vector (Human) (pORF)
ORF011515 1.0 ug DNA
EUR 95
Wdfy1 sgRNA CRISPR Lentivector set (Rat)
K7187501 3 x 1.0 ug
EUR 339
WDFY1 sgRNA CRISPR Lentivector set (Human)
K2627801 3 x 1.0 ug
EUR 339
Wdfy1 sgRNA CRISPR Lentivector set (Mouse)
K4557001 3 x 1.0 ug
EUR 339
Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7187502 1.0 ug DNA
EUR 154
Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7187503 1.0 ug DNA
EUR 154
Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7187504 1.0 ug DNA
EUR 154
WDFY1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2627802 1.0 ug DNA
EUR 154
WDFY1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2627803 1.0 ug DNA
EUR 154
WDFY1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2627804 1.0 ug DNA
EUR 154
Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4557002 1.0 ug DNA
EUR 154
Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4557003 1.0 ug DNA
EUR 154
Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4557004 1.0 ug DNA
EUR 154
WDFY1 Protein Vector (Mouse) (pPB-C-His)
PV246902 500 ng
EUR 603
WDFY1 Protein Vector (Mouse) (pPB-N-His)
PV246903 500 ng
EUR 603
WDFY1 Protein Vector (Mouse) (pPM-C-HA)
PV246904 500 ng
EUR 603

WDFY1 Rabbit Polyclonal Antibody