MC3R Rabbit Polyclonal Antibody

MC3R Rabbit Polyclonal Antibody

Contact Us Below To Order :

MC3R Polyclonal Antibody

ABP59234-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MC3R protein at amino acid sequence of 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of MC3R from Human, Mouse, Rat. This MC3R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MC3R protein at amino acid sequence of 280-360

MC3R Polyclonal Antibody

A69587 100 ?g
EUR 628.55
Description: reagents widely cited

MC3R Rabbit pAb

A11609-100ul 100 ul
EUR 308

MC3R Rabbit pAb

A11609-200ul 200 ul
EUR 459

MC3R Rabbit pAb

A11609-20ul 20 ul
EUR 183

MC3R Rabbit pAb

A11609-50ul 50 ul
EUR 223

MC3R Rabbit pAb

A11654-100ul 100 ul
EUR 308

MC3R Rabbit pAb

A11654-200ul 200 ul
EUR 459

MC3R Rabbit pAb

A11654-20ul 20 ul
EUR 183

MC3R Rabbit pAb

A11654-50ul 50 ul
EUR 223

MC3R Rabbit pAb

A3011-100ul 100 ul
EUR 308

MC3R Rabbit pAb

A3011-200ul 200 ul
EUR 459

MC3R Rabbit pAb

A3011-20ul 20 ul
EUR 183

MC3R Rabbit pAb

A3011-50ul 50 ul
EUR 223

Polyclonal MC3R Antibody (Center)

APR08365G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MC3R (Center). This antibody is tested and proven to work in the following applications:

MC3R Antibody

36971-100ul 100ul
EUR 252

MC3R antibody

38535-100ul 100ul
EUR 252

MC3R Antibody

1-CSB-PA013560LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

MC3R Antibody

CSB-PA261897-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MC3R Antibody

CSB-PA261897-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Polyclonal MC3R Antibody (C-term)

APR08364G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MC3R (C-term). This antibody is tested and proven to work in the following applications:

MC3R Polyclonal Antibody, HRP Conjugated

A69588 100 ?g
EUR 628.55
Description: Ask the seller for details

MC3R Polyclonal Antibody, FITC Conjugated

A69589 100 ?g
EUR 628.55
Description: The best epigenetics products

MC3R Polyclonal Antibody, Biotin Conjugated

A69590 100 ?g
EUR 628.55
Description: kits suitable for this type of research

MC3R Conjugated Antibody

C36971 100ul
EUR 397

MC3R Conjugated Antibody

C38535 100ul
EUR 397

anti- MC3R antibody

FNab05045 100µg
EUR 585
  • Immunogen: melanocortin 3 receptor
  • Uniprot ID: P41968
  • Gene ID: 4159
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against MC3R

Anti-MC3R antibody

PAab05045 100 ug
EUR 412

Anti-MC3R Antibody

STJ501725 100 µg
EUR 476

Anti-MC3R antibody

STJ27686 100 µl
EUR 277
Description: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans.

Anti-MC3R antibody

STJ113214 100 µl
EUR 277
Description: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans.

Anti-MC3R antibody

STJ113256 100 µl
EUR 277
Description: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans.

Anti-MC3R antibody

STJ192813 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MC3R

Mc3r/ Rat Mc3r ELISA Kit

ELI-43039r 96 Tests
EUR 886

MC3R siRNA

20-abx903183
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MC3R siRNA

20-abx923695
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MC3R siRNA

20-abx923696
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MC3R Antibody, HRP conjugated

1-CSB-PA013560LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MC3R Antibody, FITC conjugated

1-CSB-PA013560LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MC3R Antibody, Biotin conjugated

1-CSB-PA013560LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-MC3R Antibody (Biotin)

STJ501730 100 µg
EUR 586

Anti-MC3R Antibody (FITC)

STJ501731 100 µg
EUR 586

MC3R cloning plasmid

CSB-CL013560HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgagcatccaaaagacgtatctggagggagattttgtctttcctgtgagcagcagcagcttcctacggaccctgctggagccccagctcggatcagcccttctgacagcaatgaatgcttcgtgctgcctgccctctgttcagccaacactgcctaatggctcggagcacctcc
  • Show more
Description: A cloning plasmid for the MC3R gene.

MC3R cloning plasmid

CSB-CL013560HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: ATGAGCATCCAAAAGACGTATCTGGAGGGAGATTTTGTCTTTCCTGTGAGCAGCAGCAGCTTCCTACGGACCCTGCTGGAGCCCCAGCTCGGATCAGCCCTTCTGACAGCAATGAATGCTTCGTGCTGCCTGCCCTCTGTTCAGCCAACACTGCCTAATGGCTCGGAGCACCTCC
  • Show more
Description: A cloning plasmid for the MC3R gene.

Melanocortin 3 Receptor (MC3R) Antibody

20-abx126135
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody

20-abx126136
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody

20-abx002184
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody

abx034077-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody

abx034077-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody

abx332792-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody

20-abx334291
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody

abx432962-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Melanocortin 3 Receptor (MC3R) Antibody

abx235045-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Anti-MC3 Receptor/MC3R Antibody

A02841-2 100ug/vial
EUR 294

Melanocortin 3 Receptor (MC3R) Antibody (HRP)

20-abx336468
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody (FITC)

20-abx336469
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody (Biotin)

20-abx336470
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat MC3R shRNA Plasmid

20-abx985417
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MC3R ELISA KIT|Human

EF010862 96 Tests
EUR 689

Human MC3R shRNA Plasmid

20-abx952831
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MC3R shRNA Plasmid

20-abx971456
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MC3R Recombinant Protein (Human)

RP018946 100 ug Ask for price

MC3R Recombinant Protein (Human)

RP041278 100 ug Ask for price

MC3R Recombinant Protein (Rat)

RP211067 100 ug Ask for price

MC3R Recombinant Protein (Mouse)

RP149756 100 ug Ask for price

Rabbit Anti-Human Melanocortin Receptor 3 (MC3R) antiserum # 1

MCR31-S 100 ul
EUR 457

Rabbit Anti-Mouse Melanocortin Receptor 3 (MC3R) antiserum # 2

MCR32-S 100 ul
EUR 457

MC3R ORF Vector (Human) (pORF)

ORF006316 1.0 ug DNA
EUR 95

Mc3r ORF Vector (Mouse) (pORF)

ORF049920 1.0 ug DNA
EUR 506

MC3R ORF Vector (Human) (pORF)

ORF013760 1.0 ug DNA
EUR 354

Mc3r ORF Vector (Rat) (pORF)

ORF070357 1.0 ug DNA
EUR 506

Rabbit Anti-Human Melanocortin Receptor 3 (MC3R) IgG # 1, aff pure

MCR31-A 100 ug
EUR 482

Rabbit Anti-Mouse Melanocortin Receptor 3 (MC3R) IgG # 2, aff pure

MCR32-A 100 ug
EUR 482

MC3R sgRNA CRISPR Lentivector set (Human)

K1277001 3 x 1.0 ug
EUR 339

Mc3r sgRNA CRISPR Lentivector set (Mouse)

K4443101 3 x 1.0 ug
EUR 339

Mc3r sgRNA CRISPR Lentivector set (Rat)

K6870301 3 x 1.0 ug
EUR 339

Human Melanocortin receptor 3, MC3R ELISA KIT

ELI-43038h 96 Tests
EUR 824

Mouse Melanocortin receptor 3, Mc3r ELISA KIT

ELI-39668m 96 Tests
EUR 865

Rat Melanocortin Receptor 3 (MC3R) ELISA Kit

abx354241-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Melanocortin 3 Receptor (MC3R) ELISA Kit

abx388449-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

MC3R sgRNA CRISPR Lentivector (Human) (Target 1)

K1277002 1.0 ug DNA
EUR 154

MC3R sgRNA CRISPR Lentivector (Human) (Target 2)

K1277003 1.0 ug DNA
EUR 154

MC3R sgRNA CRISPR Lentivector (Human) (Target 3)

K1277004 1.0 ug DNA
EUR 154

Mc3r sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4443102 1.0 ug DNA
EUR 154

Mc3r sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4443103 1.0 ug DNA
EUR 154

Mc3r sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4443104 1.0 ug DNA
EUR 154

Mc3r sgRNA CRISPR Lentivector (Rat) (Target 1)

K6870302 1.0 ug DNA
EUR 154

Mc3r sgRNA CRISPR Lentivector (Rat) (Target 2)

K6870303 1.0 ug DNA
EUR 154

Mc3r sgRNA CRISPR Lentivector (Rat) (Target 3)

K6870304 1.0 ug DNA
EUR 154

MC3R Protein Vector (Human) (pPB-C-His)

PV055037 500 ng
EUR 481

MC3R Protein Vector (Human) (pPB-N-His)

PV055038 500 ng
EUR 481

MC3R Protein Vector (Human) (pPM-C-HA)

PV055039 500 ng
EUR 481

MC3R Protein Vector (Human) (pPM-C-His)

PV055040 500 ng
EUR 481

Human Melanocortin 3 Receptor(MC3R)ELISA Kit

QY-E03127 96T
EUR 361

MC3R Protein Vector (Rat) (pPB-C-His)

PV281426 500 ng
EUR 603

MC3R Protein Vector (Rat) (pPB-N-His)

PV281427 500 ng
EUR 603

MC3R Protein Vector (Rat) (pPM-C-HA)

PV281428 500 ng
EUR 603

MC3R Protein Vector (Rat) (pPM-C-His)

PV281429 500 ng
EUR 603

MC3R Protein Vector (Human) (pPB-C-His)

PV025261 500 ng
EUR 329

MC3R Protein Vector (Human) (pPB-N-His)

PV025262 500 ng
EUR 329

MC3R Protein Vector (Human) (pPM-C-HA)

PV025263 500 ng
EUR 329

MC3R Protein Vector (Human) (pPM-C-His)

PV025264 500 ng
EUR 329

MC3R Protein Vector (Mouse) (pPB-C-His)

PV199678 500 ng
EUR 603

MC3R Protein Vector (Mouse) (pPB-N-His)

PV199679 500 ng
EUR 603

MC3R Protein Vector (Mouse) (pPM-C-HA)

PV199680 500 ng
EUR 603

MC3R Protein Vector (Mouse) (pPM-C-His)

PV199681 500 ng
EUR 603

Mc3r 3'UTR GFP Stable Cell Line

TU162978 1.0 ml Ask for price

Mc3r 3'UTR Luciferase Stable Cell Line

TU212943 1.0 ml Ask for price

MC3R 3'UTR Luciferase Stable Cell Line

TU013090 1.0 ml
EUR 2333

Mc3r 3'UTR Luciferase Stable Cell Line

TU112978 1.0 ml Ask for price

MC3R 3'UTR GFP Stable Cell Line

TU063090 1.0 ml
EUR 2333

Mc3r 3'UTR GFP Stable Cell Line

TU262943 1.0 ml Ask for price

ELISA kit for Rat MC3R (Melanocortin Receptor 3)

E-EL-R2593 1 plate of 96 wells
EUR 534
  • Gentaur's MC3R ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat MC3R. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat MC3R (Melanocortin Receptor 3) in samples from Serum, Plasma, Cell supernatant

MC3R Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV659095 1.0 ug DNA
EUR 514

MC3R Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV659099 1.0 ug DNA
EUR 514

MC3R Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV659100 1.0 ug DNA
EUR 514

MC3R Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV703629 1.0 ug DNA
EUR 450

MC3R Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV703633 1.0 ug DNA
EUR 450

MC3R Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV703634 1.0 ug DNA
EUR 450

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

MC3R Rabbit Polyclonal Antibody