TSHR Rabbit Polyclonal Antibody

TSHR Rabbit Polyclonal Antibody

Contact Us Below To Order :

TSHR Polyclonal Antibody
ABP60783-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of TSHR from Human, Mouse, Rat. This TSHR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360
TSHR Polyclonal Antibody
ABP60783-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of TSHR from Human, Mouse, Rat. This TSHR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360
TSHR Polyclonal Antibody
ABP60783-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of TSHR from Human, Mouse, Rat. This TSHR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360
TSHR Polyclonal Antibody
A53714 100 µg
EUR 570.55
Description: Ask the seller for details
TSHR Rabbit pAb
A1012-100ul 100 ul
EUR 308
TSHR Rabbit pAb
A1012-200ul 200 ul
EUR 459
TSHR Rabbit pAb
A1012-20ul 20 ul Ask for price
TSHR Rabbit pAb
A1012-50ul 50 ul Ask for price
TSHR Rabbit pAb
A6781-100ul 100 ul
EUR 308
TSHR Rabbit pAb
A6781-200ul 200 ul
EUR 459
TSHR Rabbit pAb
A6781-20ul 20 ul
EUR 183
TSHR Rabbit pAb
A6781-50ul 50 ul
EUR 223
Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Hu-48T 48T
EUR 517
  • Should the Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Hu-96T 96T
EUR 673
  • Should the Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Mu-48T 48T
EUR 527
  • Should the Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Mu-96T 96T
EUR 688
  • Should the Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Ra-48T 48T
EUR 549
  • Should the Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Ra-96T 96T
EUR 718
  • Should the Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Hu-48Tests 48 Tests
EUR 544
Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Hu-96Tests 96 Tests
EUR 756
Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Mu-48Tests 48 Tests
EUR 557
Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Mu-96Tests 96 Tests
EUR 774
Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Ra-48Tests 48 Tests
EUR 583
Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Ra-96Tests 96 Tests
EUR 811
Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Hu-48Tests 48 Tests
EUR 521
Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Hu-96Tests 96 Tests
EUR 723
Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Mu-48Tests 48 Tests
EUR 533
Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Mu-96Tests 96 Tests
EUR 740
Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Ra-48Tests 48 Tests
EUR 557
Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Ra-96Tests 96 Tests
EUR 775
TSHR Polyclonal Antibody, Biotin Conjugated
A53711 100 µg
EUR 570.55
Description: reagents widely cited
TSHR Polyclonal Antibody, FITC Conjugated
A53712 100 µg
EUR 570.55
Description: Ask the seller for details
TSHR Polyclonal Antibody, HRP Conjugated
A53713 100 µg
EUR 570.55
Description: The best epigenetics products
TSHR antibody
70R-21027 50 ul
EUR 435
Description: Rabbit polyclonal TSHR antibody
TSHR antibody
70R-2915 50 ug
EUR 467
Description: Rabbit polyclonal TSHR antibody raised against the C terminal of TSHR
TSHR antibody
70R-5997 50 ug
EUR 467
Description: Rabbit polyclonal TSHR antibody raised against the N terminal of TSHR
TSHR antibody
70R-6004 50 ug
EUR 467
Description: Rabbit polyclonal TSHR antibody raised against the N terminal of TSHR
TSHR Antibody
35980-100ul 100ul
EUR 252
TSHR antibody
39177-100ul 100ul
EUR 252
TSHR antibody
70R-1187 100 ug
EUR 377
Description: Rabbit polyclonal TSHR antibody raised against the N terminal of TSHR
TSHR Antibody
1-CSB-PA973863
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
TSHR Antibody
DF12492 200ul
EUR 304
Description: TSHR antibody detects endogenous levels of TSHR.
TSHR Antibody
1-CSB-PA820027
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
TSHR Antibody
1-CSB-PA11189A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
TSHR Antibody
1-CSB-PA025131GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB
TSHR Conjugated Antibody
C35980 100ul
EUR 397
anti- TSHR antibody
FNab09045 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:20- 1:50
  • Immunogen: thyroid stimulating hormone receptor
  • Uniprot ID: P16473
  • Gene ID: 7253
  • Research Area: Cancer, Signal Transduction
Description: Antibody raised against TSHR
Anti-TSHR antibody
PAab09045 100 ug
EUR 386
Anti-TSHR antibody
STJ28864 100 µl
EUR 277
Description: The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene.
Anti-TSHR antibody
STJ25983 100 µl
EUR 277
Description: The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene.
Anti-TSHR antibody
STJ192807 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TSHR
Tshr/ Rat Tshr ELISA Kit
ELI-16646r 96 Tests
EUR 886
Polyclonal TSH Receptor / TSHR Antibody (C-Terminus)
APR13833G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSH Receptor / TSHR (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal TSH Receptor / TSHR Antibody (C-Terminus)
APR13834G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSH Receptor / TSHR (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal TSH Receptor / TSHR Antibody (N-Terminus)
APR13835G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSH Receptor / TSHR (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal TSHR (aa101-115) Antibody (internal region)
APR13836G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TSHR (aa101-115) (internal region). This antibody is tested and proven to work in the following applications:
TSHR siRNA
20-abx905828
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TSHR siRNA
20-abx938292
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TSHR siRNA
20-abx938293
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pOTB7-TSHR
PVT18095 2 ug
EUR 231
Thyrotropin Receptor (TSHR) Antibody
20-abx000958
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Thyrotropin Receptor (TSHR) Antibody
20-abx142283
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thyrotropin Receptor (TSHR) Antibody
20-abx005203
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thyrotropin Receptor (TSHR) Antibody
abx433417-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Thyrotropin Receptor (TSHR) Antibody
abx412917-02mg 0.2 mg
EUR 648
  • Shipped within 1 week.
Thyrotropin Receptor (TSHR) Antibody
abx413193-02mg 0.2 mg
EUR 648
  • Shipped within 1 week.
Thyrotropin Receptor (TSHR) Antibody
abx413194-20ug 20 ug
EUR 300
  • Shipped within 1 week.
Thyrotropin Receptor (TSHR) Antibody
abx239045-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
TSHR Antibody, HRP conjugated
1-CSB-PA11189B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TSHR Antibody, FITC conjugated
1-CSB-PA11189C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TSHR Antibody, Biotin conjugated
1-CSB-PA11189D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat)
4-PAC825Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHR (Pro28~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR)
TSHR cloning plasmid
CSB-CL025131HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 762
  • Sequence: atgaggccggcggacttgctgcagctggtgctgctgctcgacctgcccagggacctgggcggaatggggtgttcgtctccaccctgcgagtgccatcaggaggaggacttcagagtcacctgcaaggatattcaacgcatccccagcttaccgcccagtacgcagactctgaagct
  • Show more
Description: A cloning plasmid for the TSHR gene.
TSHR cloning plasmid
CSB-CL025131HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 762
  • Sequence: atgaggccggcggacttgctgcagctggtgctgctgctcgacctgcccagggacctgggcggaatggggtgttcgtctccaccctgcgagtgccatcaggaggaggacttcagagtcacctgcaaggatattcaacgcatccccagcttaccgcccagtacgcagactctgaagct
  • Show more
Description: A cloning plasmid for the TSHR gene.
TSHR 420 Protein
20-abx060300
  • EUR 495.00
  • EUR 1595.00
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.
TSHR Blocking Peptide
33R-4502 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-2915
TSHR Blocking Peptide
33R-5481 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-5997
TSHR Blocking Peptide
33R-1711 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-1187
TSHR Blocking Peptide
33R-2549 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-6004
TSHR Blocking Peptide
DF12492-BP 1mg
EUR 195
Recombinant Human TSHR
P0062 100ug
EUR 522.36
  • Formulation: More than 95% by SDS-PAGE gel analyses
  • Reconstitution: Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose, pH7.4
  • Purity: Thyroid-stimulating hormone receptor,TSH-R,LGR3
  • Uniprot ID: P16473
Description: Recombinant Human protein for TSHR
Anti-TSH Receptor/TSHR Antibody
A00576-1 100ug/vial
EUR 294
Anti-TSH Receptor/TSHR Antibody
PA2013 100ug/vial
EUR 334
Anti-TSHR (aa101-115) antibody
STJ72663 100 µg
EUR 359
Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), APC
4-PAC825Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHR (Pro28~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with APC.
Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), Biotinylated
4-PAC825Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHR (Pro28~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with Biotin.
Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), Cy3
4-PAC825Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHR (Pro28~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with Cy3.
Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), FITC
4-PAC825Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHR (Pro28~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with FITC.
Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), HRP
4-PAC825Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHR (Pro28~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with HRP.
Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), PE
4-PAC825Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHR (Pro28~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with PE.
Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), APC-Cy7
4-PAC825Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TSHR (Pro28~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with APC-Cy7.
Thyroid Stimulating Hormone Receptor (TSHR) Antibody
20-abx130083
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Thyroid Stimulating Hormone Receptor (TSHR) Antibody
20-abx174793
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Thyroid-Stimulating Hormone Receptor (TSHR) Antibody
20-abx210603
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thyroid-Stimulating Hormone Receptor (TSHR) Antibody
20-abx210604
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rat TSHR shRNA Plasmid
20-abx984958
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TSHR ELISA Kit
ELA-E9855h 96 Tests
EUR 824
Canine TSHR ELISA KIT
ELI-16645d 96 Tests
EUR 928
TSHR ELISA KIT|Human
EF006552 96 Tests
EUR 689
Human TSHR shRNA Plasmid
20-abx954957
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TSHR shRNA Plasmid
20-abx973235
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TSHR Recombinant Protein (Human)
RP033142 100 ug Ask for price
TSHR Recombinant Protein (Human)
RP033145 100 ug Ask for price
TSHR Recombinant Protein (Rat)
RP234971 100 ug Ask for price
TSHR Recombinant Protein (Mouse)
RP181712 100 ug Ask for price
TSHR Recombinant Protein (Mouse)
RP181715 100 ug Ask for price
h TSHR inducible lentiviral particles
LVP510 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made optional inducible lentiviral particles for expressing human target: TSHR (alternative name: CHNG1, LGR3, hTSHR-I). The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000369.2. Particles also contains a RFP-Blasticidin dual selection marker.
Tshr ORF Vector (Rat) (pORF)
ORF078325 1.0 ug DNA
EUR 506
TSHR ORF Vector (Human) (pORF)
ORF011048 1.0 ug DNA
EUR 95
TSHR ORF Vector (Human) (pORF)
ORF011049 1.0 ug DNA
EUR 95
Tshr ORF Vector (Mouse) (pORF)
ORF060572 1.0 ug DNA
EUR 506
Tshr ORF Vector (Mouse) (pORF)
ORF060573 1.0 ug DNA
EUR 506
pECMV-Tshr-m-FLAG Plasmid
PVT15360 2 ug
EUR 325
Cow Thyrotropin receptor (TSHR) ELISA Kit
abx521354-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Dog Thyrotropin receptor (TSHR) ELISA Kit
abx521355-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Thyrotropin receptor (TSHR) ELISA Kit
abx521356-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Mouse Thyrotropin receptor (TSHR) ELISA Kit
abx521357-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Pig Thyrotropin receptor (TSHR) ELISA Kit
abx521358-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Thyrotropin receptor (TSHR) ELISA Kit
abx521359-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Rat Tshr/ Thyrotropin receptor ELISA Kit
E1013Ra 1 Kit
EUR 646
Mouse Tshr/ Thyrotropin receptor ELISA Kit
E1535Mo 1 Kit
EUR 632
Human TSHR/ Thyrotropin receptor ELISA Kit
E2600Hu 1 Kit
EUR 605
Human TSHR(Thyrotropin receptor) ELISA Kit
EH2520 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: P16473
  • Alias: TSHR/CHNG1/LGR3/CHNG1/LGR3hTSHR-I/seven transmembrane helix receptor/thyroid stimulating hormone receptor/Thyroid-stimulating hormone receptor/thyrotropin receptor/thyrotropin receptor-I, hTS
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml
Bovine Thyrotropin receptor, TSHR ELISA KIT
ELI-16644b 96 Tests
EUR 928

TSHR Rabbit Polyclonal Antibody