PTH2R Rabbit Polyclonal Antibody

PTH2R Rabbit Polyclonal Antibody

Contact Us Below To Order :

PTH2R Polyclonal Antibody

ABP60024-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTH2R protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of PTH2R from Human, Mouse, Rat. This PTH2R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTH2R protein at amino acid sequence of 160-240

PTH2R Polyclonal Antibody

A54886 100 µg
EUR 570.55
Description: Ask the seller for details

PTH2R Polyclonal Antibody

30517-100ul 100ul
EUR 252

PTH2R Polyclonal Antibody

30517-50ul 50ul
EUR 187

PTH2R Rabbit pAb

A4058-100ul 100 ul
EUR 308

PTH2R Rabbit pAb

A4058-200ul 200 ul
EUR 459

PTH2R Rabbit pAb

A4058-20ul 20 ul
EUR 183

PTH2R Rabbit pAb

A4058-50ul 50 ul
EUR 223

PTH2R Polyclonal Conjugated Antibody

C30517 100ul
EUR 397

PTH2R antibody

70R-19629 50 ul
EUR 435
Description: Rabbit polyclonal PTH2R antibody

PTH2R Antibody

1-CSB-PA018990GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PTH2R Antibody

1-CSB-PA018990LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

PTH2R Polyclonal Antibody, Biotin Conjugated

A54883 100 µg
EUR 570.55
Description: reagents widely cited

PTH2R Polyclonal Antibody, FITC Conjugated

A54884 100 µg
EUR 570.55
Description: Ask the seller for details

PTH2R Polyclonal Antibody, HRP Conjugated

A54885 100 µg
EUR 570.55
Description: The best epigenetics products

Polyclonal PTHR2 / PTH2R Antibody (C-Terminus)

AMR09630G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTHR2 / PTH2R (C-Terminus). This antibody is tested and proven to work in the following applications:

Pth2r/ Rat Pth2r ELISA Kit

ELI-15494r 96 Tests
EUR 886

anti- PTH2R antibody

FNab06921 100µg
EUR 548.75
  • Immunogen: parathyroid hormone 2 receptor
  • Uniprot ID: P49190
  • Gene ID: 5746
  • Research Area: Signal Transduction
Description: Antibody raised against PTH2R

Anti-PTH2R antibody

PAab06921 100 ug
EUR 386

Anti-PTH2R antibody

STJ117808 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants.

Anti-PTH2R antibody

STJ192789 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTH2R

PTH2R siRNA

20-abx904358
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTH2R siRNA

20-abx930315
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTH2R siRNA

20-abx930316
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTH2R Antibody, HRP conjugated

1-CSB-PA018990LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PTH2R Antibody, FITC conjugated

1-CSB-PA018990LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PTH2R Antibody, Biotin conjugated

1-CSB-PA018990LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PTH2R cloning plasmid

CSB-CL018990HU-10ug 10ug
EUR 573
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1653
  • Sequence: atggccgggctgggggcgtcgctccacgtctggggttggctaatgctcggcagctgcctcctggccagagcccagctggattctgatggcaccattactatagaggagcagattgtccttgtgctgaaagcgaaagtacaatgtgaactcaacatcacagctcaactccaggagg
  • Show more
Description: A cloning plasmid for the PTH2R gene.

Rabbit Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

abx362739-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse PTH2R shRNA Plasmid

20-abx980817
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PTH2R shRNA Plasmid

20-abx986687
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PTH2R ELISA KIT|Human

EF002161 96 Tests
EUR 689

Human PTH2R shRNA Plasmid

20-abx953888
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Parathyroid Hormone 2 Receptor (PTH2R) Antibody

20-abx114334
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Parathyroid Hormone 2 Receptor (PTH2R) Antibody

20-abx110696
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Parathyroid Hormone Receptor 2 (PTH2R) Antibody

abx122357-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Parathyroid Hormone Receptor 2 (PTH2R) Antibody

abx236921-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

PTH2R ORF Vector (Human) (pORF)

ORF008378 1.0 ug DNA
EUR 95

Pth2r ORF Vector (Rat) (pORF)

ORF074287 1.0 ug DNA
EUR 506

Pth2r ORF Vector (Mouse) (pORF)

ORF055185 1.0 ug DNA
EUR 506

PTH2R sgRNA CRISPR Lentivector set (Human)

K1752001 3 x 1.0 ug
EUR 339

Pth2r sgRNA CRISPR Lentivector set (Mouse)

K3591901 3 x 1.0 ug
EUR 339

Human Parathyroid hormone 2 receptor (PTH2R)

1-CSB-EP018990HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 29.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Parathyroid hormone 2 receptor(PTH2R),partial expressed in E.coli

Pth2r sgRNA CRISPR Lentivector set (Rat)

K7009001 3 x 1.0 ug
EUR 339

PTH2R sgRNA CRISPR Lentivector (Human) (Target 1)

K1752002 1.0 ug DNA
EUR 154

PTH2R sgRNA CRISPR Lentivector (Human) (Target 2)

K1752003 1.0 ug DNA
EUR 154

PTH2R sgRNA CRISPR Lentivector (Human) (Target 3)

K1752004 1.0 ug DNA
EUR 154

Pth2r sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3591902 1.0 ug DNA
EUR 154

Pth2r sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3591903 1.0 ug DNA
EUR 154

Pth2r sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3591904 1.0 ug DNA
EUR 154

Pth2r sgRNA CRISPR Lentivector (Rat) (Target 1)

K7009002 1.0 ug DNA
EUR 154

Pth2r sgRNA CRISPR Lentivector (Rat) (Target 2)

K7009003 1.0 ug DNA
EUR 154

Pth2r sgRNA CRISPR Lentivector (Rat) (Target 3)

K7009004 1.0 ug DNA
EUR 154

PTH2R Protein Vector (Human) (pPB-C-His)

PV033509 500 ng
EUR 329

PTH2R Protein Vector (Human) (pPB-N-His)

PV033510 500 ng
EUR 329

PTH2R Protein Vector (Human) (pPM-C-HA)

PV033511 500 ng
EUR 329

PTH2R Protein Vector (Human) (pPM-C-His)

PV033512 500 ng
EUR 329

PTH2R Protein Vector (Rat) (pPB-C-His)

PV297146 500 ng
EUR 603

PTH2R Protein Vector (Rat) (pPB-N-His)

PV297147 500 ng
EUR 603

PTH2R Protein Vector (Rat) (pPM-C-HA)

PV297148 500 ng
EUR 603

PTH2R Protein Vector (Rat) (pPM-C-His)

PV297149 500 ng
EUR 603

PTH2R Protein Vector (Mouse) (pPB-C-His)

PV220738 500 ng
EUR 603

PTH2R Protein Vector (Mouse) (pPB-N-His)

PV220739 500 ng
EUR 603

PTH2R Protein Vector (Mouse) (pPM-C-HA)

PV220740 500 ng
EUR 603

PTH2R Protein Vector (Mouse) (pPM-C-His)

PV220741 500 ng
EUR 603

Pth2r 3'UTR GFP Stable Cell Line

TU167250 1.0 ml Ask for price

PTH2R 3'UTR Luciferase Stable Cell Line

TU019165 1.0 ml
EUR 1394

Pth2r 3'UTR Luciferase Stable Cell Line

TU117250 1.0 ml Ask for price

PTH2R 3'UTR GFP Stable Cell Line

TU069165 1.0 ml
EUR 1394

Pth2r 3'UTR GFP Stable Cell Line

TU267043 1.0 ml Ask for price

Pth2r 3'UTR Luciferase Stable Cell Line

TU217043 1.0 ml Ask for price

Rat Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

abx570112-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

abx360916-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human PTH2R/ Parathyroid hormone 2 receptor ELISA Kit

E2943Hu 1 Kit
EUR 605

Human Parathyroid hormone 2 receptor, PTH2R ELISA KIT

ELI-14038h 96 Tests
EUR 824

Mouse Parathyroid hormone 2 receptor, Pth2r ELISA KIT

ELI-15072m 96 Tests
EUR 865

Human Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

20-abx152888
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

abx351758-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

abx352930-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Chicken Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

abx356299-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

abx359343-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

abx255963-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

PTH2R Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV652525 1.0 ug DNA
EUR 682

PTH2R Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV652529 1.0 ug DNA
EUR 682

PTH2R Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV652530 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PTH2R Rabbit Polyclonal Antibody