LPAR4 Rabbit Polyclonal Antibody

LPAR4 Rabbit Polyclonal Antibody

Contact Us Below To Order :

LPAR4 Polyclonal Antibody
ABP59132-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LPAR4 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of LPAR4 from Human, Mouse. This LPAR4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPAR4 protein at amino acid sequence of 10-90
LPAR4 Polyclonal Antibody
A62886 100 µg
EUR 570.55
Description: reagents widely cited
LPAR4 Rabbit pAb
A3060-100ul 100 ul
EUR 308
LPAR4 Rabbit pAb
A3060-200ul 200 ul
EUR 459
LPAR4 Rabbit pAb
A3060-20ul 20 ul Ask for price
LPAR4 Rabbit pAb
A3060-50ul 50 ul
EUR 223
LPAR4 Antibody
31253-100ul 100ul
EUR 252
LPAR4 Antibody
31253-50ul 50ul
EUR 187
LPAR4 Antibody
1-CSB-PA943910
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100
LPAR4 Antibody
1-CSB-PA013050LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:200-1:500, IF:1:50-1:200
LPAR4 Antibody
1-CSB-PA281843
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000
LPAR4 Antibody
1-CSB-PA037833
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
LPAR4 Polyclonal Antibody, HRP Conjugated
A62887 100 µg
EUR 570.55
Description: Ask the seller for details
LPAR4 Polyclonal Antibody, FITC Conjugated
A62888 100 µg
EUR 570.55
Description: The best epigenetics products
LPAR4 Polyclonal Antibody, Biotin Conjugated
A62889 100 µg
EUR 570.55
Description: kits suitable for this type of research
Polyclonal LPAR4 / GPR23 Antibody (C-Terminus)
AMM06330G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPAR4 / GPR23 (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal LPAR4 / GPR23 Antibody (Cytoplasmic Domain)
APR12452G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPAR4 / GPR23 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal LPAR4 / GPR23 Antibody (N-Terminus)
APR12453G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPAR4 / GPR23 (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal LPAR4 antibody - C-terminal region
APR12454G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPAR4 - C-terminal region. This antibody is tested and proven to work in the following applications:
LPAR4 Conjugated Antibody
C31253 100ul
EUR 397
anti- LPAR4 antibody
FNab04824 100µg
EUR 505.25
  • Immunogen: lysophosphatidic acid receptor 4
  • Uniprot ID: Q99677
  • Gene ID: 2846
  • Research Area: Signal Transduction
Description: Antibody raised against LPAR4
Anti-LPAR4 antibody
PAab04824 100 ug
EUR 355
Anti-LPAR4 antibody
STJ24418 100 µl
EUR 277
Description: This gene encodes a member of the lysophosphatidic acid receptor family. It may also be related to the P2Y receptors, a family of receptors that bind purine and pyrimidine nucleotides and are coupled to G proteins. The encoded protein may play a role in monocytic differentiation.
Anti-LPAR4 antibody
STJ192781 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LPAR4
LPAR4 siRNA
20-abx922746
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
LPAR4 siRNA
20-abx922747
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
LPAR4 Antibody, HRP conjugated
1-CSB-PA013050LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
LPAR4 Antibody, FITC conjugated
1-CSB-PA013050LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
LPAR4 Antibody, Biotin conjugated
1-CSB-PA013050LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
LPAR4 cloning plasmid
CSB-CL013050HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1113
  • Sequence: atgggtgacagaagattcattgacttccaattccaagattcaaattcaagcctcagacccaggttgggcaatgctactgccaataatacttgcattgttgatgattccttcaagtataatctcaatggtgctgtctacagtgttgcattcatcttgggtctgataaccaacagtg
  • Show more
Description: A cloning plasmid for the LPAR4 gene.
Mouse LPAR4 shRNA Plasmid
20-abx978864
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human LPAR4 ELISA Kit
ELA-E0645h 96 Tests
EUR 824
LPAR4 ELISA KIT|Human
EF000680 96 Tests
EUR 689
Human LPAR4 shRNA Plasmid
20-abx951909
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
LPAR4 Recombinant Protein (Human)
RP018139 100 ug Ask for price
LPAR4 Recombinant Protein (Rat)
RP209795 100 ug Ask for price
LPAR4 Recombinant Protein (Mouse)
RP147935 100 ug Ask for price
Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody
20-abx123010
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody
20-abx214671
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody
20-abx214764
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody
20-abx318521
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody
abx234824-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody
20-abx212321
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody (HRP)
20-abx304372
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody (FITC)
20-abx304373
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody (Biotin)
20-abx304374
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
LPAR4 ORF Vector (Human) (pORF)
ORF006047 1.0 ug DNA
EUR 95
Lpar4 ORF Vector (Rat) (pORF)
ORF069933 1.0 ug DNA
EUR 506
Lpar4 ORF Vector (Mouse) (pORF)
ORF049313 1.0 ug DNA
EUR 506
LPAR4 sgRNA CRISPR Lentivector set (Human)
K1225901 3 x 1.0 ug
EUR 339
Lpar4 sgRNA CRISPR Lentivector set (Mouse)
K3832101 3 x 1.0 ug
EUR 339
Lpar4 sgRNA CRISPR Lentivector set (Rat)
K6376401 3 x 1.0 ug
EUR 339
LPAR4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1225902 1.0 ug DNA
EUR 154
LPAR4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1225903 1.0 ug DNA
EUR 154
LPAR4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1225904 1.0 ug DNA
EUR 154
Lpar4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3832102 1.0 ug DNA
EUR 154
Lpar4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3832103 1.0 ug DNA
EUR 154
Lpar4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3832104 1.0 ug DNA
EUR 154
Lpar4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6376402 1.0 ug DNA
EUR 154
Lpar4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6376403 1.0 ug DNA
EUR 154
Lpar4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6376404 1.0 ug DNA
EUR 154
LPAR4 Protein Vector (Human) (pPB-C-His)
PV024185 500 ng
EUR 329
LPAR4 Protein Vector (Human) (pPB-N-His)
PV024186 500 ng
EUR 329
LPAR4 Protein Vector (Human) (pPM-C-HA)
PV024187 500 ng
EUR 329
LPAR4 Protein Vector (Human) (pPM-C-His)
PV024188 500 ng
EUR 329
LPAR4 Protein Vector (Rat) (pPB-C-His)
PV279730 500 ng
EUR 603
LPAR4 Protein Vector (Rat) (pPB-N-His)
PV279731 500 ng
EUR 603
LPAR4 Protein Vector (Rat) (pPM-C-HA)
PV279732 500 ng
EUR 603
LPAR4 Protein Vector (Rat) (pPM-C-His)
PV279733 500 ng
EUR 603
LPAR4 Protein Vector (Mouse) (pPB-C-His)
PV197250 500 ng
EUR 603
LPAR4 Protein Vector (Mouse) (pPB-N-His)
PV197251 500 ng
EUR 603
LPAR4 Protein Vector (Mouse) (pPM-C-HA)
PV197252 500 ng
EUR 603

LPAR4 Rabbit Polyclonal Antibody