P2RY6 Rabbit Polyclonal Antibody

P2RY6 Rabbit Polyclonal Antibody

Contact Us Below To Order :

P2RY6 Polyclonal Antibody

ABP59790-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human P2RY6 protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of P2RY6 from Human, Mouse, Rat. This P2RY6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RY6 protein at amino acid sequence of 180-260

P2RY6 Polyclonal Antibody

ABP59790-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human P2RY6 protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of P2RY6 from Human, Mouse, Rat. This P2RY6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RY6 protein at amino acid sequence of 180-260

P2RY6 Rabbit pAb

A2485-100ul 100 ul
EUR 308

P2RY6 Rabbit pAb

A2485-200ul 200 ul
EUR 459

P2RY6 Rabbit pAb

A2485-20ul 20 ul
EUR 183

P2RY6 Rabbit pAb

A2485-50ul 50 ul
EUR 223

P2RY6 Antibody

ABD6956 100 ug
EUR 438

P2RY6 Antibody

37009-100ul 100ul
EUR 252

P2RY6 antibody

38404-100ul 100ul
EUR 252

P2RY6 antibody

70R-19080 50 ul
EUR 435
Description: Rabbit polyclonal P2RY6 antibody

P2RY6 Antibody

DF6956 200ul
EUR 304
Description: P2RY6 Antibody detects endogenous levels of total P2RY6.

P2RY6 Antibody

1-CSB-PA977071
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against P2RY6. Recognizes P2RY6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:100-1:300

P2RY6 Antibody

1-CSB-PA576070
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against P2RY6. Recognizes P2RY6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

P2RY6 Antibody

1-CSB-PA017337GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against P2RY6. Recognizes P2RY6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal P2RY6 Antibody (C-term)

APR17718G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY6 (C-term). This antibody is tested and proven to work in the following applications:

P2ry6/ Rat P2ry6 ELISA Kit

ELI-37027r 96 Tests
EUR 886

Polyclonal P2RY6 / P2Y6 Antibody (C-Terminus)

APR17716G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY6 / P2Y6 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal P2RY6 / P2Y6 Antibody (Cytoplasmic Domain)

APR17717G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY6 / P2Y6 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal P2RY6 Antibody - N-terminal region

APR17719G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY6 - N-terminal region. This antibody is tested and proven to work in the following applications:

P2RY6 Conjugated Antibody

C37009 100ul
EUR 397

P2RY6 Conjugated Antibody

C38404 100ul
EUR 397

anti- P2RY6 antibody

FNab06074 100µg
EUR 548.75
  • Immunogen: pyrimidinergic receptor P2Y, G-protein coupled, 6
  • Uniprot ID: Q15077
  • Research Area: Signal Transduction
Description: Antibody raised against P2RY6

Anti-P2RY6 antibody

PAab06074 100 ug
EUR 386

Anti-P2RY6 antibody

STJ24878 100 µl
EUR 277
Description: The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, which is a G-protein coupled receptor, is responsive to UDP, partially responsive to UTP and ADP, and not responsive to ATP. It is proposed that this receptor mediates inflammatory responses. Alternative splicing results in multiple transcript variants that encode different protein isoforms.

Anti-P2RY6 antibody

STJ192780 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to P2RY6

P2RY6 siRNA

20-abx903807
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

P2RY6 siRNA

20-abx927553
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

P2RY6 siRNA

20-abx927554
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

P2RY6 cloning plasmid

CSB-CL618975HU-10ug 10ug
EUR 385
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 987
  • Sequence: atggaatgggacaatggcacaggccaggctctgggcttgccacccaccacctgtgtctaccgcgagaacttcaagcaactgctgctgccacctgtgtattcggcggtgctggcggctggcctgccgctgaacatctgtgtcattacccagatctgcacgtcccgccgggccctgac
  • Show more
Description: A cloning plasmid for the P2RY6 gene.

P2RY6 Blocking Peptide

DF6956-BP 1mg
EUR 195

Rat P2RY6 shRNA Plasmid

20-abx987437
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

P2RY6 ELISA KIT|Human

EF001499 96 Tests
EUR 689

Human P2RY6 shRNA Plasmid

20-abx953344
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse P2RY6 shRNA Plasmid

20-abx982061
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

P2RY6 Recombinant Protein (Human)

RP022372 100 ug Ask for price

P2RY6 Recombinant Protein (Rat)

RP219089 100 ug Ask for price

P2RY6 Recombinant Protein (Mouse)

RP159806 100 ug Ask for price

P2RY6 ORF Vector (Human) (pORF)

ORF007458 1.0 ug DNA
EUR 95

P2ry6 ORF Vector (Rat) (pORF)

ORF073031 1.0 ug DNA
EUR 506

P2ry6 ORF Vector (Mouse) (pORF)

ORF053270 1.0 ug DNA
EUR 506

P2RY6 sgRNA CRISPR Lentivector set (Human)

K1582401 3 x 1.0 ug
EUR 339

P2ry6 sgRNA CRISPR Lentivector set (Mouse)

K3768301 3 x 1.0 ug
EUR 339

P2ry6 sgRNA CRISPR Lentivector set (Rat)

K7076901 3 x 1.0 ug
EUR 339

Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody

20-abx001929
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody

abx028562-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody

abx028562-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody

20-abx214648
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody

20-abx214804
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody

abx236074-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mouse P2Y purinoceptor 6, P2ry6 ELISA KIT

ELI-35729m 96 Tests
EUR 865

Human P2Y purinoceptor 6, P2RY6 ELISA KIT

ELI-43275h 96 Tests
EUR 824

P2RY6 sgRNA CRISPR Lentivector (Human) (Target 1)

K1582402 1.0 ug DNA
EUR 154

P2RY6 sgRNA CRISPR Lentivector (Human) (Target 2)

K1582403 1.0 ug DNA
EUR 154

P2RY6 sgRNA CRISPR Lentivector (Human) (Target 3)

K1582404 1.0 ug DNA
EUR 154

P2ry6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3768302 1.0 ug DNA
EUR 154

P2ry6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3768303 1.0 ug DNA
EUR 154

P2ry6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3768304 1.0 ug DNA
EUR 154

P2ry6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7076902 1.0 ug DNA
EUR 154

P2ry6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7076903 1.0 ug DNA
EUR 154

P2ry6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7076904 1.0 ug DNA
EUR 154

P2RY6 Protein Vector (Human) (pPB-C-His)

PV029829 500 ng
EUR 329

P2RY6 Protein Vector (Human) (pPB-N-His)

PV029830 500 ng
EUR 329

P2RY6 Protein Vector (Human) (pPM-C-HA)

PV029831 500 ng
EUR 329

P2RY6 Protein Vector (Human) (pPM-C-His)

PV029832 500 ng
EUR 329

P2RY6 Protein Vector (Mouse) (pPB-C-His)

PV213078 500 ng
EUR 603

P2RY6 Protein Vector (Mouse) (pPB-N-His)

PV213079 500 ng
EUR 603

P2RY6 Protein Vector (Mouse) (pPM-C-HA)

PV213080 500 ng
EUR 603

P2RY6 Protein Vector (Mouse) (pPM-C-His)

PV213081 500 ng
EUR 603

P2RY6 Protein Vector (Rat) (pPB-C-His)

PV292122 500 ng
EUR 603

P2RY6 Protein Vector (Rat) (pPB-N-His)

PV292123 500 ng
EUR 603

P2RY6 Rabbit Polyclonal Antibody